View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_85 (Length: 229)
Name: NF6533_low_85
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_85 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 2 - 210
Target Start/End: Original strand, 45173405 - 45173613
Alignment:
| Q |
2 |
ttggatattgttgtctttcaatttattgaaggtatggacattgttcaatcgagtttattctttttatctttatattcttaaaaccgacgaaaacatgaat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45173405 |
ttggatattgttgtctttcaatttattgaaggtatggacattgttcaatcgagtttattctttttatctttatattcttaaaaccgacgaaaacatgaat |
45173504 |
T |
 |
| Q |
102 |
gataagagtatgaacacggtataacataaaactgaaatatcccttcctcaggtttatatgtcccaagataacactttaaacacttttcgtgaaaggggaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45173505 |
gataagagtatgaacacggtataacataaaactgaaatatcccttcctcaggtttatatgtcccaagataacactttaaacacttttcgtgaaaggggaa |
45173604 |
T |
 |
| Q |
202 |
aaataaaac |
210 |
Q |
| |
|
||||||||| |
|
|
| T |
45173605 |
aaataaaac |
45173613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University