View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_87 (Length: 227)
Name: NF6533_low_87
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_87 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 67 - 203
Target Start/End: Complemental strand, 43142752 - 43142613
Alignment:
| Q |
67 |
ttacacaattgaacgcactttgtttgagaacactaattgatggtattagtacgtagcatggttttgttctctttgccactcctctct---ttctatgatt |
163 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
43142752 |
ttacacaattgaacgcaatttgtttgagaacactaattgatggtattagtacatagcatggttttgttctctttgccactcctctctttattctatggtt |
43142653 |
T |
|
| Q |
164 |
gtccccttttaactcacttcaaccatcattgttaatgttc |
203 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43142652 |
gtccccttttaactcatttcaaccatcattgttaatgttc |
43142613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University