View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6533_low_89 (Length: 220)

Name: NF6533_low_89
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6533_low_89
NF6533_low_89
[»] chr7 (1 HSPs)
chr7 (20-202)||(6984013-6984195)


Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 6984195 - 6984013
Alignment:
20 gatcgaacctctaggacattgagaaagtggtgagtgaggagtgattgtaggccgtgtttggagagggtgtgaacgtgagaaacaaattgatgagtagtga 119  Q
    ||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
6984195 gatcgaacctctaagactttgagaaagtggggagtgaggagtgattgtaggccgtgtttgcagagggtgtgaacgtgagaaacaaattgatgagtagtga 6984096  T
120 atgagaggtgatcgtggagaagaagagattgtgtggcgttgcagaatgcgttgtagctttcaaggatttcgttaacttcatct 202  Q
    |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||    
6984095 atgagatgtgatcgtggagaagaagagattgtgtggcgttgcagaaggcgttgtagctttcaatgatttcgttaacttcatct 6984013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University