View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_89 (Length: 220)
Name: NF6533_low_89
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_89 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 202
Target Start/End: Complemental strand, 6984195 - 6984013
Alignment:
| Q |
20 |
gatcgaacctctaggacattgagaaagtggtgagtgaggagtgattgtaggccgtgtttggagagggtgtgaacgtgagaaacaaattgatgagtagtga |
119 |
Q |
| |
|
||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6984195 |
gatcgaacctctaagactttgagaaagtggggagtgaggagtgattgtaggccgtgtttgcagagggtgtgaacgtgagaaacaaattgatgagtagtga |
6984096 |
T |
 |
| Q |
120 |
atgagaggtgatcgtggagaagaagagattgtgtggcgttgcagaatgcgttgtagctttcaaggatttcgttaacttcatct |
202 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6984095 |
atgagatgtgatcgtggagaagaagagattgtgtggcgttgcagaaggcgttgtagctttcaatgatttcgttaacttcatct |
6984013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University