View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6533_low_91 (Length: 210)

Name: NF6533_low_91
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6533_low_91
NF6533_low_91
[»] chr5 (2 HSPs)
chr5 (156-194)||(30773472-30773510)
chr5 (54-97)||(30774424-30774467)
[»] chr4 (1 HSPs)
chr4 (152-188)||(17983405-17983441)
[»] chr2 (1 HSPs)
chr2 (152-188)||(2997149-2997185)


Alignment Details
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 194
Target Start/End: Complemental strand, 30773510 - 30773472
Alignment:
156 taagtcttgagtttttatgatttgtattaggactttttg 194  Q
    |||||||||||||||||||||||||||||||| ||||||    
30773510 taagtcttgagtttttatgatttgtattaggattttttg 30773472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 97
Target Start/End: Complemental strand, 30774467 - 30774424
Alignment:
54 gaataagaatatatattgacaggaataattttgttttgttgatc 97  Q
    ||||||||||||||  ||| ||||||||||||||||||||||||    
30774467 gaataagaatatatcctgataggaataattttgttttgttgatc 30774424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 188
Target Start/End: Complemental strand, 17983441 - 17983405
Alignment:
152 ctattaagtcttgagtttttatgatttgtattaggac 188  Q
    |||||||||||||||||||||| ||||||||||||||    
17983441 ctattaagtcttgagtttttattatttgtattaggac 17983405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 188
Target Start/End: Complemental strand, 2997185 - 2997149
Alignment:
152 ctattaagtcttgagtttttatgatttgtattaggac 188  Q
    |||||||||||||||||||||| ||||||||||||||    
2997185 ctattaagtcttgagtttttattatttgtattaggac 2997149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University