View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6533_low_94 (Length: 206)
Name: NF6533_low_94
Description: NF6533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6533_low_94 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 37809229 - 37809055
Alignment:
| Q |
1 |
tttatggtatttgaggaatatgataacactttttggaggccaaagttttcagctcttcatatcatgaagctttagttattcttggtttgccaatggatga |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809229 |
tttatggtattggaggaatatgataacactttttggaggccaaagttttcagctcttcatatcatgaagctttagttattcttggtttgccaatggatga |
37809130 |
T |
 |
| Q |
101 |
taatgtttgttattaggagtctttgtcacttgtcaggagcttatgttataggaatttttgttcttcaattgattc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809129 |
taatgtttgttattaggagtctttgtcacttgtcaggagcttatgttataggaatttttgttcttcaattgattc |
37809055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 72
Target Start/End: Complemental strand, 2809117 - 2809065
Alignment:
| Q |
20 |
atgataacactttttggaggccaaagttttcagctcttcatatcatgaagctt |
72 |
Q |
| |
|
||||||| || ||| |||||| ||||||||||||||||||| | ||||||||| |
|
|
| T |
2809117 |
atgataatacatttcggaggctaaagttttcagctcttcatgtgatgaagctt |
2809065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University