View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6534_high_10 (Length: 412)
Name: NF6534_high_10
Description: NF6534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6534_high_10 |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0023 (1 HSPs) |
 |  |  |
|
| [»] scaffold0247 (2 HSPs) |
 |  |  |
|
| [»] scaffold0193 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 2e-96; HSPs: 20)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 33698756 - 33698533
Alignment:
| Q |
1 |
gccgaggatgaaattgatatgattctaaggttacacaaacttctagggaacaagtaagctatcaagttaattttgttttggttacctatcaaattaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
33698756 |
gccgaggatgaaattgatatgattctaaggttacacaaacttctagggaacaagtaagctatcaagttaattttgttttggttacctatcaagttaaact |
33698657 |
T |
 |
| Q |
101 |
tttggtgacctaggtaagagtataatat----atgtttgtatgtatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaag |
196 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33698656 |
tttggtgacctaagtaagagtataatatatgtatgtatgtatgtatagatggtctttgattgctgcaaggcttccgggtaggacagctaatgatgtgaag |
33698557 |
T |
 |
| Q |
197 |
aattattggcacacaaatttgcgc |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33698556 |
aattattggcacacaaatttgcgc |
33698533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 277 - 396
Target Start/End: Complemental strand, 33698476 - 33698357
Alignment:
| Q |
277 |
catgatcaaatctcatgaagttatcaagccacgacctcgaactttttcaactcattcactatggttgaagaagaaacataatttcgtgagtaatggtagt |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33698476 |
catgatcaaatctcatgaagttatcaagcctcgacctcgaactttttcaactcattcactatggttgaagaagaaacataatttcgtgagtaatggtagt |
33698377 |
T |
 |
| Q |
377 |
gcaacaaaactagtgatttc |
396 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33698376 |
gcaacaaaactagtgatttc |
33698357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 277 - 396
Target Start/End: Complemental strand, 33679759 - 33679640
Alignment:
| Q |
277 |
catgatcaaatctcatgaagttatcaagccacgacctcgaactttttcaactcattcactatggttgaagaagaaacataatttcgtgagtaatggtagt |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
33679759 |
catgatcaaatctcatgaagttatcaagcctcgacctcgaactttttcaactcattcactatggttgaagaagaaacgtaattttgtgagtgatggtagt |
33679660 |
T |
 |
| Q |
377 |
gcaacaaaactagtgatttc |
396 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33679659 |
gcaacaaaactagtgatttc |
33679640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 136 - 220
Target Start/End: Complemental strand, 33679900 - 33679816
Alignment:
| Q |
136 |
tatgtatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaatttgcgc |
220 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33679900 |
tatgtatagatggtcattgattgctgcgaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaatttgcgc |
33679816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 142 - 217
Target Start/End: Complemental strand, 33904474 - 33904399
Alignment:
| Q |
142 |
tagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaatttg |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33904474 |
tagatggtcattgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacacatttg |
33904399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 140 - 216
Target Start/End: Complemental strand, 33865967 - 33865891
Alignment:
| Q |
140 |
tatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaattt |
216 |
Q |
| |
|
||||||||||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33865967 |
tatagatggtcattgattgctgcaagactcccgggtagaacagctaatgatgtgaagaattattggcacacacattt |
33865891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 143 - 219
Target Start/End: Complemental strand, 33762843 - 33762767
Alignment:
| Q |
143 |
agatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaatttgcg |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
33762843 |
agatggtcattgattgctgcaaggcttcccggtagaacagcgaatgatgtgaaaaactattggcacacaaatttgcg |
33762767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 140 - 219
Target Start/End: Complemental strand, 33734384 - 33734305
Alignment:
| Q |
140 |
tatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaatttgcg |
219 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| |||||||||||||| || | |||||||||| ||||||| |
|
|
| T |
33734384 |
tatagatggtcattgattgctgcaaggcttcctggtagaactgctaatgatgtgaaaaacttttggcacacacatttgcg |
33734305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 140 - 219
Target Start/End: Complemental strand, 33821714 - 33821635
Alignment:
| Q |
140 |
tatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaatttgcg |
219 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| |||||||||||||| || |||||| ||||| ||||||| |
|
|
| T |
33821714 |
tatagatggtcattgattgctgcaaggcttcctagtagaacggctaatgatgtgaaaaactattggaacacacatttgcg |
33821635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 4 - 60
Target Start/End: Complemental strand, 33734593 - 33734537
Alignment:
| Q |
4 |
gaggatgaaattgatatgattctaaggttacacaaacttctagggaacaagtaagct |
60 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||| | ||||||| |
|
|
| T |
33734593 |
gaggatgaagttgatatgatcctaaggttacacaaacttctagggaataggtaagct |
33734537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 33748856 - 33748786
Alignment:
| Q |
140 |
tatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacac |
210 |
Q |
| |
|
||||||||| || ||||||||||||| |||| ||||||||||||||||||||||| || |||||| |||| |
|
|
| T |
33748856 |
tatagatggacgttgattgctgcaagacttcaaggtagaacagctaatgatgtgaaaaactattggaacac |
33748786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 140 - 210
Target Start/End: Complemental strand, 33834976 - 33834906
Alignment:
| Q |
140 |
tatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacac |
210 |
Q |
| |
|
||||||||| || ||||||||||||| |||| ||||||||||||||||||||||| || |||||| |||| |
|
|
| T |
33834976 |
tatagatggacgttgattgctgcaagacttcaaggtagaacagctaatgatgtgaaaaactattggaacac |
33834906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 4 - 50
Target Start/End: Complemental strand, 33904652 - 33904606
Alignment:
| Q |
4 |
gaggatgaaattgatatgattctaaggttacacaaacttctagggaa |
50 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33904652 |
gaggatgaagttgatatgatgctaaggttacacaaacttctagggaa |
33904606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 290 - 351
Target Start/End: Complemental strand, 33762702 - 33762641
Alignment:
| Q |
290 |
catgaagttatcaagccacgacctcgaactttttcaactcattcactatggttgaagaagaa |
351 |
Q |
| |
|
||||||||||| || || | |||||||| ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
33762702 |
catgaagttattaaacctcaacctcgaattttttcaactcattcaccatggttgaacaagaa |
33762641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 288 - 345
Target Start/End: Complemental strand, 33865822 - 33865765
Alignment:
| Q |
288 |
ctcatgaagttatcaagccacgacctcgaactttttcaactcattcactatggttgaa |
345 |
Q |
| |
|
||||||||||||| || || | |||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
33865822 |
ctcatgaagttattaaacctcaacctcgaactttttcatctcattcaccatggttgaa |
33865765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 33867091 - 33867043
Alignment:
| Q |
4 |
gaggatgaaattgatatgattctaaggttacacaaacttctagggaaca |
52 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| ||| ||||||||| |
|
|
| T |
33867091 |
gaggatgaagttgatatgattttaaggttacacaagcttttagggaaca |
33867043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 288 - 355
Target Start/End: Complemental strand, 33734239 - 33734172
Alignment:
| Q |
288 |
ctcatgaagttatcaagccacgacctcgaactttttcaactcattcactatggttgaagaagaaacat |
355 |
Q |
| |
|
||||||||||||| || || | |||||||| |||||||||||||||| ||||||||| | ||||||| |
|
|
| T |
33734239 |
ctcatgaagttattaaaccccaacctcgaattttttcaactcattcatcatggttgaataggaaacat |
33734172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 7 - 41
Target Start/End: Complemental strand, 33680154 - 33680120
Alignment:
| Q |
7 |
gatgaaattgatatgattctaaggttacacaaact |
41 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
33680154 |
gatgaaattgatatgattctaaggctacacaaact |
33680120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 365
Target Start/End: Complemental strand, 33834831 - 33834754
Alignment:
| Q |
288 |
ctcatgaagttatcaagccacgacctcgaactttttcaactcattcactatggttgaagaagaaacataatttcgtga |
365 |
Q |
| |
|
|||||||||||||||| || || || |||||||||||||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
33834831 |
ctcatgaagttatcaaacctcgtccattaactttttcaactcattcaccttggttgaatgggaaacataattttgtga |
33834754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 4 - 60
Target Start/End: Complemental strand, 33763423 - 33763367
Alignment:
| Q |
4 |
gaggatgaaattgatatgattctaaggttacacaaacttctagggaacaagtaagct |
60 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||| ||||||||||| || | ||||||| |
|
|
| T |
33763423 |
gaggatgaagttgatctgatcctaaggttacaaaaacttctaggtaataggtaagct |
33763367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 140 - 217
Target Start/End: Complemental strand, 21305952 - 21305875
Alignment:
| Q |
140 |
tatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaatttg |
217 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21305952 |
tatagatggtcattgattgctggaaggcttccgggtagaacagctaatgatgtgaagaactattggcacacaaatttg |
21305875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 142 - 211
Target Start/End: Complemental strand, 148859 - 148790
Alignment:
| Q |
142 |
tagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacaca |
211 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
148859 |
tagatggtcattgattgctggaaggcttccgggaagaacagctaatgatgtaaagaactattggcacaca |
148790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 4 - 50
Target Start/End: Complemental strand, 149053 - 149007
Alignment:
| Q |
4 |
gaggatgaaattgatatgattctaaggttacacaaacttctagggaa |
50 |
Q |
| |
|
||||||||| | |||||||| |||||||||||||||||||||||||| |
|
|
| T |
149053 |
gaggatgaagtcgatatgatcctaaggttacacaaacttctagggaa |
149007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0023 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0023
Description:
Target: scaffold0023; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 140 - 217
Target Start/End: Original strand, 114205 - 114282
Alignment:
| Q |
140 |
tatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacacaaatttg |
217 |
Q |
| |
|
||||||||||| ||||||| | ||||||||||| |||||||||||||||||| || || |||||||||||| ||||| |
|
|
| T |
114205 |
tatagatggtcattgattgcgggaaggcttccggctagaacagctaatgatgtcaaaaactattggcacacacatttg |
114282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0247 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0247
Description:
Target: scaffold0247; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 143 - 205
Target Start/End: Original strand, 22155 - 22217
Alignment:
| Q |
143 |
agatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattgg |
205 |
Q |
| |
|
|||||||| ||||||||| ||||||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
22155 |
agatggtcattgattgctggaaggcttccaggtagaacagctaatgatgtgaaaaactattgg |
22217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0247; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 21958 - 22013
Alignment:
| Q |
5 |
aggatgaaattgatatgattctaaggttacacaaacttctagggaacaagtaagct |
60 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||||| || | ||||||| |
|
|
| T |
21958 |
aggatgaagttgatttgattctaaggttacacaaccttctaggcaataggtaagct |
22013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 142 - 211
Target Start/End: Original strand, 5471194 - 5471263
Alignment:
| Q |
142 |
tagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacaca |
211 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||| |||||| || |||||| ||||| |
|
|
| T |
5471194 |
tagatggtcattgattgctggaaggcttccgggtagaacagctaatagtgtgaaaaactattggaacaca |
5471263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 41
Target Start/End: Original strand, 5470212 - 5470249
Alignment:
| Q |
4 |
gaggatgaaattgatatgattctaaggttacacaaact |
41 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
5470212 |
gaggatgaagttgatatgatcctaaggttacacaaact |
5470249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0193 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0193
Description:
Target: scaffold0193; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 210
Target Start/End: Original strand, 25216 - 25286
Alignment:
| Q |
140 |
tatagatggtcgctgattgctgcaaggcttccgggtagaacagctaatgatgtgaagaattattggcacac |
210 |
Q |
| |
|
||||||||| | ||||||||||||| |||| ||||||| |||||||||||||||| || |||||| |||| |
|
|
| T |
25216 |
tatagatggacattgattgctgcaagacttcagggtagatcagctaatgatgtgaaaaactattggaacac |
25286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University