View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6534_low_25 (Length: 252)
Name: NF6534_low_25
Description: NF6534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6534_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 14 - 163
Target Start/End: Original strand, 7306124 - 7306273
Alignment:
| Q |
14 |
agcgggtatacattgaaatgaaattctgagtaacaaatcatgtatcccaacttcggcctccgtgtctgcaaaccctgtcaaagatgacaacatcaattac |
113 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7306124 |
agcgagtatacattgaaatgaaattctcagtaacaaatcatgtatcccaacttcggcctccgtgtctgcaaaccctgtcaaagattacaacatcaattac |
7306223 |
T |
|
| Q |
114 |
caatttttacatatgtttggattcatttgctctacaaatccaactaaata |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7306224 |
caatttttacatatgtttggattcatttgctctacaaatccaactaaata |
7306273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 114
Target Start/End: Complemental strand, 7227082 - 7226995
Alignment:
| Q |
27 |
tgaaatgaaattctgagtaacaaatcatgtatcccaacttcggcctccgtgtctgcaaaccctgtcaaagatgacaacatcaattacc |
114 |
Q |
| |
|
|||||||||| | | ||| ||||||| |||||||||||| | |||| | | ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7227082 |
tgaaatgaaactttcagtcacaaatcttgtatcccaactgcagccttcctctctgcaaaccctgacaaagatgacaacatcaattacc |
7226995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 100 - 147
Target Start/End: Complemental strand, 7226986 - 7226939
Alignment:
| Q |
100 |
acaacatcaattaccaatttttacatatgtttggattcatttgctcta |
147 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7226986 |
acaatatcaattaccaatttttacatatgtttggattcattagctcta |
7226939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University