View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6534_low_27 (Length: 249)
Name: NF6534_low_27
Description: NF6534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6534_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 42 - 249
Target Start/End: Original strand, 42098183 - 42098390
Alignment:
| Q |
42 |
cttttctattttgaaaacaatatttttcatgtgattatgttcaaacctcatcgttttcacttgtgtgtgtgaattttaatgtaaccaatgctacgactat |
141 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
42098183 |
cttttctattttgaaaataatatttttcatgtgattatgttcaaacttcatcgttttcacttgtgtgtgtgaattttgatgtaaccaatgatacgactat |
42098282 |
T |
 |
| Q |
142 |
ttaaagatttgtgggnnnnnnnnnnnnnnnnnnnnnnnnnttgttgaagttttagttaaatgagtaactcagcactcctttttcttatataagaaaagaa |
241 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42098283 |
ttaaagatttgtgggaaagatgtaaaaaaagaaaaaaaaattgttgaagttttagttaaatgagtaactcagtactcctttttcttatataagaaaagaa |
42098382 |
T |
 |
| Q |
242 |
gttattct |
249 |
Q |
| |
|
| |||||| |
|
|
| T |
42098383 |
gctattct |
42098390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University