View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6534_low_36 (Length: 206)
Name: NF6534_low_36
Description: NF6534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6534_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 16 - 201
Target Start/End: Complemental strand, 32960603 - 32960418
Alignment:
| Q |
16 |
aaacatgtgtgtttcatctttggtttgtggaaaaccaagcctagctgcatgttgttgaaaattgggtgaggatagcattgaggaaggagaagatagtggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32960603 |
aaacatgtgtgtttcatctttggtttgtggaaaaccaagcctagctgcatgttgttgaaaattgggtgaggatagcattgaggaaggagaagatagtggt |
32960504 |
T |
 |
| Q |
116 |
ctctgaccccagttgaagagtggtggaggtggcctaattggaatggtggaagatggttttgaaggaagtgaagttgatgatgatgt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32960503 |
ctctgaccccagttgaagagtggtggaggtggcctaattggaatggtggaagatggttttgaaggaagtgaagttgatgaggatgt |
32960418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University