View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6534_low_37 (Length: 201)
Name: NF6534_low_37
Description: NF6534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6534_low_37 |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0088 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 9 - 159
Target Start/End: Complemental strand, 47835 - 47685
Alignment:
| Q |
9 |
gacatcatcatatgagtatacctttatcagtttttgagtttgtgctaccatgccaaatggccttcctaatgcgaggatgaagaaatattgcagggccttc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47835 |
gacaacatcatatgagtatacctttatcagttattgagtctgtgctaccatgccaaatggccttcctaatgcgaggatgaagaaatattgcagggccttc |
47736 |
T |
 |
| Q |
109 |
atcgaatgatgaactgtgtccccaaggcactccaagaagagttgaggttgc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47735 |
gacgaatgatgaactgtgtccccaaggcactccaagaagagttgaggttgc |
47685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University