View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6534_low_8 (Length: 468)
Name: NF6534_low_8
Description: NF6534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6534_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 428; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 428; E-Value: 0
Query Start/End: Original strand, 19 - 458
Target Start/End: Original strand, 9433912 - 9434351
Alignment:
| Q |
19 |
acgctgtacaagctttgctctgttaagcagaacaaggagagagctgttagtgctggtgtggtgaagccgttggtggagctggtggctgagcaagggaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9433912 |
acgctgtacaagctttgctctgttaagcagaacaaggagagagctgttagtgctggtgtggtgaagccgttggtggagctggtggctgagcaagggaatg |
9434011 |
T |
 |
| Q |
119 |
ggatgatggagaaagcaatggtggtgttgaatagcttagcggggtttgacgaagggaaggaagcgattgtggaagaaggtggaattgcggcgcttgtgga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9434012 |
ggatgatggagaaagcaatggtggtgttgaatagcttagcggggtttgacgaagggaaggaagccattgtggaagaaggtggaattgctgcgcttgtgga |
9434111 |
T |
 |
| Q |
219 |
agccattgaagatgggtctgtgaaaggaaaagaatttgctgttttaacacttttgcagctttgtgctgaaagtgttaccaatagaggtttgcttgttaga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9434112 |
agccattgaagatgggtctgtgaaaggaaaagaatttgctgttttaacacttttgcagctttgtgctgaaagtgttaccaatagaggtttgcttgttaga |
9434211 |
T |
 |
| Q |
319 |
gaaggtgggattcctcctcttgtcgctctttcgcaaaatggaactcctcgagctaagcataaggtaaatttcaatctctgcattttgcttcatactatat |
418 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9434212 |
gaaggtgggattcctcctcttgtcgctctttcgcaaaatggaactcctcgagctaagcataaggtaaatttcaatctctgcattttgcttcatactatag |
9434311 |
T |
 |
| Q |
419 |
gattcaaaagatttattcatatgtatatttgtttagtatt |
458 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9434312 |
gattcaaaagatttattcatatgtatatttgtttagtatt |
9434351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University