View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6535_low_9 (Length: 253)
Name: NF6535_low_9
Description: NF6535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6535_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 106 - 253
Target Start/End: Original strand, 3851236 - 3851380
Alignment:
| Q |
106 |
aaaactcaaaaaatcatattgaagttgtccatttaatgatggctccattgaggatctcaaattgtaatcatcttcaagtttcatccaagtagagtaatca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3851236 |
aaaactcaaaaaatcatattgaagttgtccatttaatg---gctccattgaggatctcaaattgtaatcatcttcaagtttcatccaagtagagtaatca |
3851332 |
T |
 |
| Q |
206 |
ggcataaaaccttcactagaattattatcactactccattgttgaatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3851333 |
ggcataaaaccttcactagaattattatcactactccattgttcaatt |
3851380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University