View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6536_high_10 (Length: 274)
Name: NF6536_high_10
Description: NF6536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6536_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 30723570 - 30723832
Alignment:
| Q |
1 |
atttagagctacccttctctgcttatacatcacatattctttttaattactcttatatgttagaagaattggtgcttgagatgcattgtggttttatcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |||| ||| |||||| |
|
|
| T |
30723570 |
atttagagctacccttctctgcttatacatcacatattctttttaattactcttataagttagaagaattggttcttgagatgcgttgttgttctatcaa |
30723669 |
T |
 |
| Q |
101 |
agttcctccctgcagttcttattatacttgtagttttggaagcctaaatgttatcaagttgtgtggaattatgttcaccatggacgaatctctaggtatt |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30723670 |
agttcctccctgcagttcttatgatacttgtagttttggaagcctaaatgttatcaagttgtgtggaattatgttcaccatggatgaatctctaggtatt |
30723769 |
T |
 |
| Q |
201 |
cttttccgaacactgaaaaagtttgagatgaaaaactgttcttggttgagtacagatgatgtc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30723770 |
cttttccgaacactgaaaaagtttgagatgaaaaactgttcttggttgagtacagatgatgtc |
30723832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University