View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6537_high_9 (Length: 363)
Name: NF6537_high_9
Description: NF6537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6537_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 10 - 344
Target Start/End: Complemental strand, 52369433 - 52369102
Alignment:
| Q |
10 |
attatacttatgggggtgtctgttactgatttgtcaaataatgggtccaataagatgagtacttcaagcaggttgagtgattgcagacctcaacacatga |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52369433 |
attatatttatgggggtgtctgttactgatttgtcaaat---gggtccaataagatgagtacttcaagcaggttgagtgattgcagacctcaacatatga |
52369337 |
T |
 |
| Q |
110 |
ttcttgaaagaaaccattcatttgttcaagataaagaacaaaacatggattcatccaaaagtgatcaattgaaacataaacaagttccagtgatttctct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
52369336 |
ttcttgaaagaaaccattcatttgttcaagataaagaacagaacatggattcaaccaaaagtgatcaattgaaacataaacaagttccattgatttctct |
52369237 |
T |
 |
| Q |
210 |
gcctgaagcacttgttttttcttctccaagaccagtttctgagcttgatgctgctgcaactactcttcaaaaagtttacaagagttaccgtactagaaga |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369236 |
gcctgaagcacttgttttttcttctccaaggccagtttctgagctcgatgctgctgcaactactcttcaaaaagtttacaagagttaccgtactagaaga |
52369137 |
T |
 |
| Q |
310 |
aaccttgccgattgtgcagtggttgtggaagagct |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369136 |
aaccttgccgattgtgcagtggttgtggaagagct |
52369102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 203 - 335
Target Start/End: Original strand, 17492226 - 17492358
Alignment:
| Q |
203 |
tttctctgcctgaagcacttgttttttcttctccaagaccagtttctgagcttgatgctgctgcaactactcttcaaaaagtttacaagagttaccgtac |
302 |
Q |
| |
|
||||| ||||| ||| | ||||||| |||||||||| ||| |||| ||||||||||||||| ||||||| |||| |||||||| |||||||| | || |
|
|
| T |
17492226 |
tttctttgcctaaagaagttgttttctcttctccaaaacctgtttttgagcttgatgctgcagcaactaaggttcagaaagtttataagagttatagaac |
17492325 |
T |
 |
| Q |
303 |
tagaagaaaccttgccgattgtgcagtggttgt |
335 |
Q |
| |
|
||||||||| ||||| |||||||| || ||||| |
|
|
| T |
17492326 |
tagaagaaatcttgctgattgtgccgttgttgt |
17492358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University