View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6538_high_2 (Length: 239)
Name: NF6538_high_2
Description: NF6538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6538_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 45927468 - 45927247
Alignment:
| Q |
1 |
ttctcacaatttgaatcagcttcttttgatcaactccaatgaccatggaaaagaattaacattggaaactatannnnnnnatacatgatgatatcttatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45927468 |
ttctcacaatttgaatcagcttcttttgatcaactccaatgaccatggaaaagaattaacattggaaactatatttttttatacatgatgatatcttatc |
45927369 |
T |
|
| Q |
101 |
agctcttctaatctttttccccctaaaaaatttataatcatgcaataacaagtgatacaaactttagatttcaagtgttttctacttggtctagattata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45927368 |
agctcttctaatctttttccccctaaaaaatttataatcatgcaataacaagtgatacaaactttagatttcaagtgttttctacttggtctagattata |
45927269 |
T |
|
| Q |
201 |
gatttttacaactctatattag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45927268 |
gatttttacaactctatattag |
45927247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 7 - 62
Target Start/End: Complemental strand, 15806037 - 15805984
Alignment:
| Q |
7 |
caatttgaatcagcttcttttgatcaactccaatgaccatggaaaagaattaacat |
62 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15806037 |
caatttggatcagcttcttttgatcaacaccaatgaccatgg--aagaattaacat |
15805984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University