View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6539_low_9 (Length: 224)
Name: NF6539_low_9
Description: NF6539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6539_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 32 - 210
Target Start/End: Complemental strand, 13050831 - 13050652
Alignment:
| Q |
32 |
atgggatcgtttgcaagcatcggtaaacgttttgaaaatgcttactgagtagaactctgcaggttgcaacaagaaggagaaatgactaatcacgttaggg |
131 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| ||||| |||| |||||||||||||||||||||| |||||| |
|
|
| T |
13050831 |
atgggatcgtttgcaagcattggtaaacgttttgaaaatgcttactgagcagaactctacaggtggcaataagaaggagaaatgactaatcatgttaggt |
13050732 |
T |
|
| Q |
132 |
cggttaatgtgccaactggttaatagtcacattcgaataatatggggcttct-gtttgtctccaactactacctatgcta |
210 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||| ||||||| ||||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
13050731 |
tggttgatgtgacaactggttaattgtcacattcaaataatacggggcttctggtttgtctccaactgctacctgtgcta |
13050652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University