View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6540_high_26 (Length: 361)
Name: NF6540_high_26
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6540_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 170 - 342
Target Start/End: Complemental strand, 26748527 - 26748357
Alignment:
| Q |
170 |
gttgagggaaagattggtatgttaagtgtgaagaagagtctcatattcaacgtcaggnnnnnnnnnnnnngtctcatattagattaaaaagtagatgtta |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
26748527 |
gttgagggaaagattggtatgttaagtgtgaagaagagtcttatattcaacgtca--aagaaaaaatagagtcttatattagattaaaaagtagatgtta |
26748430 |
T |
|
| Q |
270 |
cacaatatctataagtgaattctttttcacatatatttaatacttcaaagttttggtttattgatacctaaac |
342 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26748429 |
cacaatatctataagtggattctttttcacatatatttaatacttcaaagttttggtttattgatacctaaac |
26748357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 13 - 115
Target Start/End: Complemental strand, 26748639 - 26748535
Alignment:
| Q |
13 |
aaaatgtctc--atagatgatgtttgtcaacggccagtctcaacaaaactttagctatcaacgaatgtctatatatttgaaaggtgttgcagcaaatgta |
110 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26748639 |
aaaatgtctcgtatagatgatgtttgtcaatggccagtctcaacaaaactttagctatcaacgaatgtctatatatttgaagggtgttgcagcaaatgta |
26748540 |
T |
|
| Q |
111 |
tgtag |
115 |
Q |
| |
|
||||| |
|
|
| T |
26748539 |
tgtag |
26748535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University