View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6540_high_32 (Length: 313)
Name: NF6540_high_32
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6540_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 10 - 297
Target Start/End: Original strand, 4252737 - 4253031
Alignment:
| Q |
10 |
acatcatcagatgatgagctttcgccatttcccttttccttttgagtatc-------aagacccttatcggcttttgcctcttcccttctttgtcggagt |
102 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4252737 |
acatcctcagatgatgagctttcaccatttcccttttccttttgagtatcaactatcaagacccttatcggcttttgcctcttcccttcttcgtcggagt |
4252836 |
T |
 |
| Q |
103 |
ccacatgcgttacacaaccactgcaccaacatatttcttgttaactatataatatatctaataactagatattcaaattattaataaatgacacatttgc |
202 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4252837 |
ctacatgcgttacacaaccactgcaccaacatatttcttgttaactatataatatatttaataactagatattcaaattattaataaatgccacatttgc |
4252936 |
T |
 |
| Q |
203 |
atgaaccaaaagtgaaagttgatagtaaaataaagagatgaactaattaccttggaacccgtaggatcactactccaaagaggagtagtgtttgt |
297 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4252937 |
atgaaccaaaagtgaaagttgatagaaaaataaagagatgaactaattaccttggaacccgtaggatcactactccaaagaggagtagtgtttgt |
4253031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University