View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6540_high_61 (Length: 228)
Name: NF6540_high_61
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6540_high_61 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 8 - 228
Target Start/End: Original strand, 11137181 - 11137400
Alignment:
| Q |
8 |
taattatcttcatgaattgtagcggctatagcggggataggatataaatgcccctttcaatttcatgttttcccatttcataatgttcctaaccaacacc |
107 |
Q |
| |
|
||||||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11137181 |
taattatcttcatgaatagcagcggctatagcggagataggatataaatgcccctttcaatttcatgttttcccatttcataatgttcctaaccaacacc |
11137280 |
T |
 |
| Q |
108 |
cctcacatctaatactgtcccattgaaggctcagttttgtcgtacctctgaatctggtacctatttctgaactagataatctgaataatattttgataca |
207 |
Q |
| |
|
| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11137281 |
c-tcacatctaatactgtcccattgaaagctcggttttgtcgtacctctgaatctggtacctatttctgaactagataatctgaataatattttgataca |
11137379 |
T |
 |
| Q |
208 |
aataataaatatctcatctat |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11137380 |
aataataaatatctcatctat |
11137400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University