View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6540_low_36 (Length: 312)

Name: NF6540_low_36
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6540_low_36
NF6540_low_36
[»] chr5 (3 HSPs)
chr5 (17-154)||(6607828-6607965)
chr5 (229-269)||(6607713-6607753)
chr5 (264-294)||(6607626-6607656)


Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 17 - 154
Target Start/End: Complemental strand, 6607965 - 6607828
Alignment:
17 atgatacagattactaagggaattcaataaaaagattacacttgtttaattcctgtaaatggtgagcatatggtgaagatagaaagatcgttctcaaaat 116  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
6607965 atgatacagattaataagggaattcaataaaaagattacacttgtttaattcctgtaaatggtgagcatatcgtgaagatagaaagatcgttctcaaaat 6607866  T
117 cgcgattttatcataaagaggaagtagaaggtgtctct 154  Q
    ||||||||||||||||||||||||||||||||||||||    
6607865 cgcgattttatcataaagaggaagtagaaggtgtctct 6607828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 229 - 269
Target Start/End: Complemental strand, 6607753 - 6607713
Alignment:
229 tgagcccgaaaaagaatctcgggtgagccactaaaattaat 269  Q
    |||||||||||||||||||||||||||||||||||||||||    
6607753 tgagcccgaaaaagaatctcgggtgagccactaaaattaat 6607713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 294
Target Start/End: Complemental strand, 6607656 - 6607626
Alignment:
264 attaatcatcaactttgaaatttgcatagtt 294  Q
    |||||||||||||||||||||||||||||||    
6607656 attaatcatcaactttgaaatttgcatagtt 6607626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University