View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6540_low_44 (Length: 290)
Name: NF6540_low_44
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6540_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 33 - 272
Target Start/End: Complemental strand, 43509227 - 43508988
Alignment:
| Q |
33 |
tggatcactctcgttgactaagattatgtgcaattttaaattcaattgtagaactgttactaattatctaacagctgacatcaatagtattctatcacaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43509227 |
tggatcactctcgttgactaagattatgtgcaattttaaattcaattgtagaactgttactaattatctaacagctgacatcaatagtattctatcacaa |
43509128 |
T |
 |
| Q |
133 |
caaaattgaatgcaacaaataaattcttttcatgtttatcttgaacgtgatgtatgacaccggatcatttgcatttgctcccggtttcatataccagtac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43509127 |
caaaattgaatgcaacaaataaattcttttcatgtttatcttgaacgtgatgtatgacaccggatcatttgcatttgctcccggtttcatataccagtac |
43509028 |
T |
 |
| Q |
233 |
actgtatgttataactatttggatttgctcttgtcaaaaa |
272 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43509027 |
actgtatgttataactatttggatttgcttttgtcaaaaa |
43508988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University