View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6540_low_57 (Length: 247)
Name: NF6540_low_57
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6540_low_57 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 116 - 247
Target Start/End: Original strand, 43442871 - 43443002
Alignment:
| Q |
116 |
acctacaatacaacgttacttcttgaggggaaggacaaaccaaactgcatattcgtttttatggcgtacttggaattggaaatataataaacacgttggt |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43442871 |
acctacaatacaacggtacttcttgaggggaaggacaaaccaaactgcatattcgtttttatggcgtacttggaattggaaatataataaacacgttggt |
43442970 |
T |
 |
| Q |
216 |
tctttgttttctatgatgttttgctcgtacgt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43442971 |
tctttgttttctatgatgttttgctcgtacgt |
43443002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Original strand, 43442791 - 43442885
Alignment:
| Q |
1 |
ccaatttagagttgaactaactggtaaatcatataatcattctcttatttaattttaggtagatgtggggaaggaaaacgacctacaatacaacg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43442791 |
ccaatttagagttgaactaactggtaaatcatataatcattctcttatttaattttaggtagatgtggggaaggaaaacgacctacaatacaacg |
43442885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University