View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6540_low_58 (Length: 247)
Name: NF6540_low_58
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6540_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 66 - 217
Target Start/End: Complemental strand, 28584791 - 28584640
Alignment:
| Q |
66 |
aagttttcctaccagctctttactccctctgttcttgttgaggtttactccaagaatgtggctagttttgtgaacaatggattttgtgccattgcgactc |
165 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28584791 |
aagttttcctaccaggtctttactctctctgttcttgttgaggtttactccaaaaatgtggctagttttgtgaacaatggattttgtgccattgcgactc |
28584692 |
T |
|
| Q |
166 |
tcttgtctctccttattgaagtggttcatctgcttcctgctatggagcacat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28584691 |
tcttgtctctccttattgaagtggttcatctgcttcctgctatggagcacat |
28584640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 91 - 229
Target Start/End: Original strand, 28418484 - 28418623
Alignment:
| Q |
91 |
cctctgttcttgttgaggttt-actccaagaatgtggctagttttgtgaacaatggattttgtgccattgcgactctcttgtctctccttattgaagtgg |
189 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28418484 |
cctctgttcttgttgaggttttactccacgaatgtggctagttttgtgaacaatgaatcttgtgccattgcgactctcgggtctctccttattgaagtgg |
28418583 |
T |
|
| Q |
190 |
ttcatctgcttcctgctatggagcacatgcctctctttct |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28418584 |
ttcatctgcttcctgctatggagcacatgcctctctttct |
28418623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 28418423 - 28418486
Alignment:
| Q |
1 |
cctcttgacttctcttacaagttatcctctccatgcttagcctttggagtttctactattgcct |
64 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28418423 |
cctcttgacttcttttacaagttatcctctccatgcttagcctttggagtttgtactattgcct |
28418486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University