View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6540_low_71 (Length: 215)

Name: NF6540_low_71
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6540_low_71
NF6540_low_71
[»] chr3 (1 HSPs)
chr3 (11-198)||(51968020-51968207)


Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 51968207 - 51968020
Alignment:
11 tgtcgaagaatatctgaagcagcttctcaaataacaaatgatagccccagatttcaaagtagcaccccaagatcaacaaaatcccctagagttaactcaa 110  Q
    ||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51968207 tgtcgaacaataactgaagcagcttctcaaataacaaatgatagccccagatttcaaagtagcaccccaagatcaacaaaatcccctagagttaactcaa 51968108  T
111 tatcaaatcctacttctcctcgctctcctttgaagttgtccctcttcaaaaacagcttcaaattcagggtatgaattccttttttcct 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51968107 tatcaaatcctacttctcctcgctctcctttgaagttgtccctcttcaaaaacagcttcaaattcagggtatgaattccttttttcct 51968020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University