View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6540_low_71 (Length: 215)
Name: NF6540_low_71
Description: NF6540
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6540_low_71 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 198
Target Start/End: Complemental strand, 51968207 - 51968020
Alignment:
| Q |
11 |
tgtcgaagaatatctgaagcagcttctcaaataacaaatgatagccccagatttcaaagtagcaccccaagatcaacaaaatcccctagagttaactcaa |
110 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51968207 |
tgtcgaacaataactgaagcagcttctcaaataacaaatgatagccccagatttcaaagtagcaccccaagatcaacaaaatcccctagagttaactcaa |
51968108 |
T |
|
| Q |
111 |
tatcaaatcctacttctcctcgctctcctttgaagttgtccctcttcaaaaacagcttcaaattcagggtatgaattccttttttcct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51968107 |
tatcaaatcctacttctcctcgctctcctttgaagttgtccctcttcaaaaacagcttcaaattcagggtatgaattccttttttcct |
51968020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University