View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6542_high_12 (Length: 232)
Name: NF6542_high_12
Description: NF6542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6542_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 189
Target Start/End: Complemental strand, 26616560 - 26616392
Alignment:
| Q |
21 |
gtacaggaaaacaaaattggggtttctcagactttgaaatgtaactgaaatcaaacacactgcgaatttcgtttttgacaaaggttgtgttgttgggtta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26616560 |
gtacaggaaaacaaaattggggtttctcagactttgacatgtaactgaaatcaaacacactgcgaatttcgtttttgacaaaggttgtgttgttgggtta |
26616461 |
T |
 |
| Q |
121 |
tggtggaggaggatgcgtcaatcgttattggcgatggtggtgcgtcgtttgttgaaatacttgttgagg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26616460 |
tggtggaggaggatgcgtcaatcgttattggcgatggtggtgcgtcgtttgttgaaatacttgtcgagg |
26616392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 189
Target Start/End: Complemental strand, 26722488 - 26722320
Alignment:
| Q |
21 |
gtacaggaaaacaaaattggggtttctcagactttgaaatgtaactgaaatcaaacacactgcgaatttcgtttttgacaaaggttgtgttgttgggtta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26722488 |
gtacaggaaaacaaaattggggtttctcagactttgacatgtaactgaaatcaaacacactgcgaatttcgtttttgacaaaggttgtgttgttgggtta |
26722389 |
T |
 |
| Q |
121 |
tggtggaggaggatgcgtcaatcgttattggcgatggtggtgcgtcgtttgttgaaatacttgttgagg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26722388 |
tggtggaggaggatgcgtcaatcgttattggcgatggtggtgcgtcgtttgttgaaatacttgtcgagg |
26722320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University