View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6542_low_12 (Length: 239)
Name: NF6542_low_12
Description: NF6542
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6542_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 31 - 229
Target Start/End: Complemental strand, 3965728 - 3965532
Alignment:
| Q |
31 |
tggaggatggtaaaacgttcaagagaatgaaagatgcaaaatcttacctttgaatatgcagagatggacggataaaagaaatggaaacaaaacaattaat |
130 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3965728 |
tggaggatggtaaaacgtttaagagaatgaaagatgcaaaatcttacctttgaatatgcagagatggacggataaaagaaatggaaacaaaaca----at |
3965633 |
T |
 |
| Q |
131 |
tagggattgatttaactacg--tattaactaatgcaattgatttgttatgtaacctaatatttaatgatgataagtcagaagcaaataaataaagaataa |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3965632 |
tagggattgatttaactacgtatattaactaatgcaattaatttgttatgtaacctaataattaatgatgataagtcagaagcaaataaataacgaataa |
3965533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University