View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6543_high_2 (Length: 272)
Name: NF6543_high_2
Description: NF6543
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6543_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 46002205 - 46002345
Alignment:
| Q |
1 |
caggctgccaccatatgttccgtagctgnnnnnnnttcaggtaaatacattgaaggaatatttcaaaaaccataatatcgaatcggtgagatctctagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46002205 |
caggctgccaccatatgttccgtagctgaaaaaaattcaggtaaatacattgaaggaatatttcaaaaaccataatatcaaatcggtgagatctctagtc |
46002304 |
T |
 |
| Q |
101 |
atgattcaatcgattcaactagagtcgagttaaattagatg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46002305 |
atgattcaatcgattcaactagagtcgagttaaattagatg |
46002345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 264
Target Start/End: Original strand, 46002427 - 46002464
Alignment:
| Q |
227 |
aattagttgaaccggtgcaaccatccgacagtataatc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46002427 |
aattagttgaaccggtgcaaccatccgacagtataatc |
46002464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University