View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6544_low_16 (Length: 251)
Name: NF6544_low_16
Description: NF6544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6544_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 46445259 - 46445496
Alignment:
| Q |
1 |
ttgagaatgattt--gtgttaagagataggtgaccatcaccccggtaatctgtataaacctgcttgtctgcttcgaagttttttgttgagtgacttatta |
98 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46445259 |
ttgagaatgattttagtgttaagagataggtgaccatcaccccggtaatctgtataaacctgcttgtctgctttgaagttttttgttgagtgacttatta |
46445358 |
T |
 |
| Q |
99 |
gctatgtagcaaatgacacttcaaattaaa--tgtgttggaggatccaacatgtgtcggtgtccgacactaacatgtgtagtacattcgaacactttcat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
46445359 |
gctatgtagcaaatgacacttcaaattaaatgtgtgttggaggatccaacatgtgtcggtgtccgacactaataggtgtagtacattcgaacactttcat |
46445458 |
T |
 |
| Q |
197 |
ttatcaaattttaccagtatatgtcagggtgatatcca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46445459 |
ttatcaaattttaccagtatatgtcagggtgatatcca |
46445496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University