View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6544_low_17 (Length: 248)
Name: NF6544_low_17
Description: NF6544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6544_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 41955292 - 41955165
Alignment:
| Q |
1 |
cttcgaatagatataacttgaaattggaatttagagttttcatttgtaattttttgttatcaatctattgttcaaattatatttatatgaatttattcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41955292 |
cttcgaatagatataacttgaaattgggatttagagttttcatctgttattttttgttatcaatctattgttcaaattatatttatatgaatttattcaa |
41955193 |
T |
 |
| Q |
101 |
acataaattacttcgtatttagttcact |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41955192 |
acataaattacttcgtatttagttcact |
41955165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 134 - 236
Target Start/End: Complemental strand, 41954899 - 41954797
Alignment:
| Q |
134 |
agagagaggctctcccttctctctagaaaatgtcccccaaatcttagggtttggtggccgccccccaccttcatgttgggtttcttcccccacctctttg |
233 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
41954899 |
agagagaggctctcccttctctatagaaaatgccccccaaatcttagggtttggtggccgccccccaccttcatgttgggtttcttcccccacctttttg |
41954800 |
T |
 |
| Q |
234 |
gtg |
236 |
Q |
| |
|
||| |
|
|
| T |
41954799 |
gtg |
41954797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 134 - 236
Target Start/End: Original strand, 2545211 - 2545314
Alignment:
| Q |
134 |
agagagaggctctcccttctctctagaaaatgtcccc-caaatcttagggtttggtggccgccccccaccttcatgttgggtttcttcccccacctcttt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2545211 |
agagagaggctctcccttctctctagaaaatgtccccccaaatcttagggtttggtggccaacccccaccttcatggtgggtttcttcccccacctcttc |
2545310 |
T |
 |
| Q |
233 |
ggtg |
236 |
Q |
| |
|
|||| |
|
|
| T |
2545311 |
ggtg |
2545314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 131 - 236
Target Start/End: Original strand, 35706564 - 35706670
Alignment:
| Q |
131 |
tctagagagaggctctcccttctctctagaaaatgtcccc--caaatcttagggtttggtggccgccccccaccttcatgttgggtttcttcccccacct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
35706564 |
tctagagagaggctctcccttctctctagaaaatgccccccccaaatcttagggtttggtggccgccccccaccttcatagtggatttctt-ccccacct |
35706662 |
T |
 |
| Q |
229 |
ctttggtg |
236 |
Q |
| |
|
|||||||| |
|
|
| T |
35706663 |
ctttggtg |
35706670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 134 - 203
Target Start/End: Complemental strand, 11789568 - 11789498
Alignment:
| Q |
134 |
agagagaggctctcccttctctctagaaaatgtccccc-aaatcttagggtttggtggccgccccccacct |
203 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
11789568 |
agagagaagctctcccttctctcttgaaaatgtccccccaaatcttagggtttggtggcggccccccacct |
11789498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 162 - 236
Target Start/End: Complemental strand, 7202848 - 7202774
Alignment:
| Q |
162 |
aatgtcccccaaatcttagggtttggtggccgccccccaccttcatgttgggtttcttcccccacctctttggtg |
236 |
Q |
| |
|
|||| |||||||||||||||||||||||| | | ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7202848 |
aatgccccccaaatcttagggtttggtggtttcgcaccaccttcatggtgggtttcttcccccacctctttggtg |
7202774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 167 - 236
Target Start/End: Complemental strand, 30402058 - 30401989
Alignment:
| Q |
167 |
cccccaaatcttagggtttggtggccgccccccaccttcatgttgggtttcttcccccacctctttggtg |
236 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30402058 |
cccccaaatcttagggtttggtggccaccccccaccttcatggtgggtttcttcccccacctctttggtg |
30401989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 132 - 236
Target Start/End: Original strand, 36136655 - 36136759
Alignment:
| Q |
132 |
ctagagagaggctctcccttctctctagaaaatgtcccc-caaatcttagggtttggtggccgccccccaccttcatgttgggtttcttcccccacctct |
230 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||| |||| ||||||||| ||||| ||||| | |||||| || |||| |||||||||||| |||||||| |
|
|
| T |
36136655 |
ctagagataggctctcccttctttctagaaaatgccccctcaaatcttaaggtttagtggctg-cccccatctacatggtgggtttcttccaccacctct |
36136753 |
T |
 |
| Q |
231 |
ttggtg |
236 |
Q |
| |
|
|||||| |
|
|
| T |
36136754 |
ttggtg |
36136759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University