View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6544_low_5 (Length: 418)
Name: NF6544_low_5
Description: NF6544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6544_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 134 - 371
Target Start/End: Original strand, 30193129 - 30193363
Alignment:
| Q |
134 |
gaacgagaataattttcatttatgtcaaattacatttttgatctattaagtactatttatttaagtagtatcgttctaatcctttaattaaaatttaatt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||| || ||| ||||||||||||||||| |
|
|
| T |
30193129 |
gaacgagaataattttcatttatgtcaaattacatttttgatctattaa---ctatttatttaagtaatattgttttagtcccttaattaaaatttaatt |
30193225 |
T |
|
| Q |
234 |
tagcctttcatttatcactacttgcttcattcagaattttcattaccagtcaccatccccttatcaacaacacaatccttatctcaaaccttcattgcaa |
333 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30193226 |
tagcctttcatttatcactacatgcttcattcagaattttcattaccagtcaccatccccttatcaacaacacaatccttatctcaaaccttcattgcaa |
30193325 |
T |
|
| Q |
334 |
aacccaaaacccacatacaagtgataaagtagaagaag |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30193326 |
aacccaaaacccacatacaagtgataaagtagaagaag |
30193363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University