View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6544_low_8 (Length: 356)
Name: NF6544_low_8
Description: NF6544
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6544_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 19 - 341
Target Start/End: Original strand, 54885980 - 54886302
Alignment:
| Q |
19 |
ctgtgtgttcatgttgttgatccgggctcgacacttaatggacgaatggctgtcagcgcaacctcactctcagccttcatctatgcagaacaggtcagaa |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54885980 |
ctgtgtgttcatgtttttgatccgggctcgacacttaatggacgaatggctgtcagcgcaacctcagtctcagccttcatctatgcagaacaggtcagaa |
54886079 |
T |
|
| Q |
119 |
catgccagaggcacctctcagcagcgcctacaatcacagtctcggcatgtgcgtccaccgtcagcaagtccttctctgtggcagaaaccacatcccggta |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54886080 |
catgccagaggcacctctcagcagctcctacaatcacagtctcggcatgtgcatccaccgtcagcaagtccttctctgtggcagaaaccacaacccggta |
54886179 |
T |
|
| Q |
219 |
gagtaaagtgtaacattgacgcttcttctcttcctcttggaaccgtacaggtattggggtctgtttacgcgatgaagatggcacctttatccttgctcaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54886180 |
gagtaaagtgtaacattgacgcttcttctcttcctcttggaaccgtacaggtattggggcctgtttacgcgatgaagatggcacctttatccttgctcaa |
54886279 |
T |
|
| Q |
319 |
actatgagttttcctataaagta |
341 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
54886280 |
actatgagttttcctataaagta |
54886302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University