View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6546_high_16 (Length: 309)
Name: NF6546_high_16
Description: NF6546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6546_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 40416272 - 40416139
Alignment:
| Q |
1 |
gtggcttcaataactcttggtatgagcacaaatgctgcttatgttgaaccagcacaagaaagtgagcttgcacgatctcccaattcaaatgaacttgtta |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40416272 |
gtggctgcaataactcttggtatgagcacaaatgctgcttatgttgaaccagcacaagaaagtgagcttgcacgatctcccaattcaaatgaactggtta |
40416173 |
T |
 |
| Q |
101 |
gtgactgccatagtctttacattgttttttacgc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40416172 |
gtgactgccatagtctttacattgttttttacgc |
40416139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 169 - 289
Target Start/End: Complemental strand, 40416104 - 40415984
Alignment:
| Q |
169 |
gaaccacttatctaaaccatccggttttaaggggaatgggattttagtgaatatagaactcgggaggtaaataaagtttaattaagattgtttcaaccag |
268 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40416104 |
gaaccacttatctaaaccatccggttttcaggggaatgggattttagtgaatatagaattcgggaggtaaataaagtttaattaagattgtttcaaccag |
40416005 |
T |
 |
| Q |
269 |
aattcgaacttaatttctctg |
289 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
40416004 |
aattcaaacttaatttctctg |
40415984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University