View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6546_high_17 (Length: 291)
Name: NF6546_high_17
Description: NF6546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6546_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 19 - 287
Target Start/End: Complemental strand, 28497203 - 28496935
Alignment:
| Q |
19 |
ctttaaatatttttggtttcattcaagtttggtttatggatttttcttgtcttttggctgaacgatacactcagccaagtagccaacaactctctcttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28497203 |
ctttaaatatttttggtttcattcaagtttggtttatggatttttcttgtcttttggctgaacgatacactcagccaagtagccaacaactctctcttta |
28497104 |
T |
|
| Q |
119 |
aagaaccatccaaaagaatttatgttcactttcttggcttttgctaatcttaaaccattgttttcttccttgtactgactgaaactaataaaaacctttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28497103 |
aagaaccatccaaaagaatttatgttcactttcttggcttttgctaatcttaaaccattgttttcttccttgtactgactgaaactaataaaaacctttg |
28497004 |
T |
|
| Q |
219 |
aaagttagtggnnnnnnncttcttctctttcactttcttggccttattactatatagtttcttctcact |
287 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28497003 |
aaagttagtggtttttttcttcttctctttcactttcttggccttattactatatagtttcttatcact |
28496935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University