View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6546_low_1 (Length: 531)
Name: NF6546_low_1
Description: NF6546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6546_low_1 |
 |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (1 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0472 (1 HSPs) |
 |  |  |
|
| [»] scaffold0347 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 50)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 49 - 287
Target Start/End: Complemental strand, 44952246 - 44952012
Alignment:
| Q |
49 |
attggcatgtttgaatgtagtcagaggcagtaatatatagttgtaaattagatttgcacaagaggaacttacgatgacgtgggtcatatctcttattccc |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952246 |
attggcatgtttgaatgtagtcagaggcagtaatatatagttgtaaattagctttgcacaagaggaacttacgatgacgtgggtcatatctcttattccc |
44952147 |
T |
 |
| Q |
149 |
gtgttcttatccgtacgtagaccgtggttgccacactcttaacaattatggtaaagcttatatcatgcatttgtgaggagtccacacgcatttcccagtt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952146 |
gtgttcttatccgtacgtagaccgtggttgccacactcttaacaaatatggtaaagcttatatcatgcatttgtgaggagtccacacgcatttcccagtt |
44952047 |
T |
 |
| Q |
249 |
ttgtagtatcttaattgattgaccaatcaccatgatttt |
287 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44952046 |
ttgtagtatc----ttgattgaccaatcaccatgatttt |
44952012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 6827871 - 6827824
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
6827871 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
6827824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 9445952 - 9445999
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
9445952 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
9445999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 11285506 - 11285553
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
11285506 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
11285553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 13064162 - 13064209
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
13064162 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
13064209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 287 - 341
Target Start/End: Original strand, 5797477 - 5797531
Alignment:
| Q |
287 |
tcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||| || |||||| ||||||| |
|
|
| T |
5797477 |
tcttggttaaaatatgattttggtctctgcaaatatgtctcgttttggttttagt |
5797531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 44952295 - 44952261
Alignment:
| Q |
15 |
gacatcatcttccaattttaaaatggattttgcta |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952295 |
gacatcatcttccaattttaaaatggattttgcta |
44952261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 296 - 341
Target Start/End: Complemental strand, 27008401 - 27008356
Alignment:
| Q |
296 |
aaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagt |
27008356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 35415635 - 35415583
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35415635 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35415583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 55482470 - 55482418
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||| |||||| ||||||| |
|
|
| T |
55482470 |
ttggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagt |
55482418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 4279332 - 4279285
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
4279332 |
taaaatatgattttagtccctgcaaatatggctcgttttggttttagt |
4279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 12791971 - 12791924
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
12791971 |
taaaatatgatttttgtccctgcaaatatgcctcgttttggttttagt |
12791924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 13064462 - 13064415
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
13064462 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
13064415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 15555506 - 15555553
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
15555553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 16712688 - 16712641
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
16712688 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16712641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 18205159 - 18205206
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
18205159 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18205206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 20291989 - 20292036
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
20291989 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
20292036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 22099546 - 22099593
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
22099546 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22099593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 23778967 - 23779014
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
23778967 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 32208545 - 32208592
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
32208545 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32208592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 32208898 - 32208851
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||| || |||||||||||||| |||||||||||||| |
|
|
| T |
32208898 |
taaaatatggttttaatccctgcaaatatgcctcgttttgattttagt |
32208851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 32365097 - 32365144
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
32365097 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32365144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 35763650 - 35763697
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35763650 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35763697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 35763952 - 35763905
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||||| ||||||| |
|
|
| T |
35763952 |
taaaatatgattttagtccctgcagatatgcctcgttttggttttagt |
35763905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 36702003 - 36702050
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
36702003 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
36702050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 38054549 - 38054596
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
38054596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 41345856 - 41345903
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
41345856 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
41345903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 41619902 - 41619949
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
41619949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 45505603 - 45505650
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
45505603 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
45505650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 45505891 - 45505844
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
45505891 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
45505844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 45593583 - 45593536
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||||| ||||||| |
|
|
| T |
45593583 |
taaaatatggttttagtctctgcaaatatgtctcgttttggttttagt |
45593536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 51545966 - 51545919
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
51545919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 52017508 - 52017555
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
52017508 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
52017555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 52017867 - 52017820
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
52017867 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
52017820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 52441766 - 52441813
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
52441766 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
52441813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 53717171 - 53717124
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
53717171 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
53717124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 53915686 - 53915733
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
53915686 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
53915733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 283 - 341
Target Start/End: Complemental strand, 35464390 - 35464332
Alignment:
| Q |
283 |
attttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||| |||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35464390 |
atttttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
35464332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 287 - 341
Target Start/End: Original strand, 41920764 - 41920818
Alignment:
| Q |
287 |
tcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||| ||||||||| |||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
41920764 |
tcttggttaaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 296 - 341
Target Start/End: Original strand, 2034544 - 2034589
Alignment:
| Q |
296 |
aaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
2034589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 41324897 - 41324840
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||| ||||||||| |||| ||||||||||||||||| |||||| ||||||| |
|
|
| T |
41324897 |
tttttttggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagt |
41324840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 55072709 - 55072664
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
55072664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 297 - 341
Target Start/End: Complemental strand, 5052578 - 5052534
Alignment:
| Q |
297 |
aatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
5052578 |
aatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5052534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 23245229 - 23245281
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
23245229 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
23245281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 294 - 338
Target Start/End: Complemental strand, 29463910 - 29463866
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttt |
338 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| |||| |
|
|
| T |
29463910 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
29463866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 294 - 342
Target Start/End: Original strand, 42823779 - 42823827
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagta |
342 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| || |||||| |||||||| |
|
|
| T |
42823779 |
taaaatatgattttggtccctgcaaatatgtctcgttttggttttagta |
42823827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 42824093 - 42824041
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| ||||||||||| || |||||||||||||| |
|
|
| T |
42824093 |
ttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagt |
42824041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 46115412 - 46115464
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
46115412 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
46115464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 46128546 - 46128598
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
46128546 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
46128598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 50714238 - 50714290
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
50714238 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
50714290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 53)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 29151514 - 29151566
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
29151514 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagt |
29151566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 293831 - 293878
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
293831 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
293878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 10408931 - 10408978
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
10408931 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
10408978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 10409323 - 10409276
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
10409323 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
10409276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 16038737 - 16038690
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
16038737 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
16038690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 20683750 - 20683797
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
20683750 |
taaaatatggttttagtctctgcaaatatgcatcgttttgattttagt |
20683797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 27850371 - 27850324
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| ||||||| |
|
|
| T |
27850371 |
taaaatatgattttagtctctgcaaatatgtctcgttttggttttagt |
27850324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 39379242 - 39379289
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
39379289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 293 - 341
Target Start/End: Complemental strand, 20418014 - 20417966
Alignment:
| Q |
293 |
ataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
20418014 |
ataaaatatggtttaagtctctgcaaatatgtctcgttttgattttagt |
20417966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 281 - 341
Target Start/End: Original strand, 23381940 - 23382000
Alignment:
| Q |
281 |
tgattttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| | || ||||||||| |||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
23381940 |
tgattttataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
23382000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 28550825 - 28550877
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
28550825 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
28550877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 28863840 - 28863788
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
28863840 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
28863788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 1104861 - 1104908
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
1104861 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
1104908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 2217497 - 2217544
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
2217497 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
2217544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 2217851 - 2217804
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
2217851 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
2217804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 4203459 - 4203506
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
4203459 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 4203767 - 4203720
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
4203767 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
4203720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 5614169 - 5614216
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
5614169 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
5614216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 5614527 - 5614480
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
5614527 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5614480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 5950179 - 5950226
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
5950179 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
5950226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 7075575 - 7075622
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
7075575 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
7075622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 10743727 - 10743774
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
10743727 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10743774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 16038380 - 16038427
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
16038380 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16038427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 18046041 - 18046088
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
18046041 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
18046088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 18046345 - 18046298
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
18046345 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18046298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 18633602 - 18633649
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
18633602 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18633649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 20986086 - 20986039
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
20986086 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
20986039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 21050578 - 21050625
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| || ||||||||| | |||||||||||||| |
|
|
| T |
21050578 |
taaaatatgattttagtccctacaaatatgcttcgttttgattttagt |
21050625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 21050910 - 21050863
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
21050910 |
taaaatatggttttagtccctgcaaatatgcatcgttttgattttagt |
21050863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 23382294 - 23382247
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
23382294 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
23382247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 28863513 - 28863560
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
28863513 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
28863560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 29172526 - 29172573
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29172526 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29172573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 29172883 - 29172836
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29172883 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29172836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 29692747 - 29692794
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29692747 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29692794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 29693087 - 29693040
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||| ||||||| |
|
|
| T |
29693087 |
taaaatatgattttagtccctgcaaatatgcttcgttttggttttagt |
29693040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 29875403 - 29875450
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||||||||| || |||||||||||||| |||||| ||||||| |
|
|
| T |
29875403 |
taaaatatgattttaatccctgcaaatatgcctcgttttggttttagt |
29875450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 29875722 - 29875675
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29875722 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29875675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 30800497 - 30800544
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
30800497 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
30800544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 30800847 - 30800800
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
30800847 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
30800800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 31037398 - 31037445
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
31037398 |
taaaatatggttttagtccctgcaaatataccttgttttgattttagt |
31037445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 35167162 - 35167115
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35167162 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35167115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 36578080 - 36578033
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
36578080 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
36578033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 37271362 - 37271409
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
37271362 |
taaaatatggttttggtctctgcaaatatgcctcgttttggttttagt |
37271409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 40029494 - 40029447
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
40029494 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
40029447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 289 - 339
Target Start/End: Complemental strand, 6118501 - 6118451
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
6118501 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
6118451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 289 - 339
Target Start/End: Complemental strand, 18633963 - 18633913
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
18633963 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
18633913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 294 - 340
Target Start/End: Original strand, 35166914 - 35166960
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttag |
340 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
35166914 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 289 - 339
Target Start/End: Complemental strand, 40038860 - 40038810
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||| |||||| ||||| |
|
|
| T |
40038860 |
ttggctaaaatatgattttggtccctgcaaatatgccttgttttggtttta |
40038810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 289 - 339
Target Start/End: Original strand, 42994066 - 42994116
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| || |||||||||||| |
|
|
| T |
42994066 |
ttggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 25561996 - 25561951
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
25561996 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 20985723 - 20985775
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
20985723 |
ttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
20985775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 29366951 - 29366899
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
29366951 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
29366899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 33336028 - 33335976
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
33336028 |
ttggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagt |
33335976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 47)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 489069 - 489022
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
489069 |
taaaatatgattttagtctctgcaaatatgtctcgttttgattttagt |
489022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 6079812 - 6079859
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
6079812 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
6079859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 18022701 - 18022654
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
18022701 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
18022654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 21554750 - 21554703
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
21554750 |
taaaatatggttttagtccctgcaaatatgccttgttttgattttagt |
21554703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 32189387 - 32189340
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
32189387 |
taaaatatggttttagtctctgcaaatatgcctcgttttggttttagt |
32189340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 35015217 - 35015170
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
35015217 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
35015170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 284 - 346
Target Start/End: Original strand, 7431944 - 7432006
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagtatttg |
346 |
Q |
| |
|
|||| |||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |||| |
|
|
| T |
7431944 |
ttttattggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttg |
7432006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 289 - 339
Target Start/End: Original strand, 31732099 - 31732149
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
31732099 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
31732149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 46648712 - 46648667
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
46648712 |
taaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 1006833 - 1006885
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
1006833 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1006885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 21554391 - 21554443
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||||||| ||| |||||||||| |||||| ||||||| |
|
|
| T |
21554391 |
ttggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagt |
21554443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 25547492 - 25547440
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
25547492 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
25547440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 283 - 339
Target Start/End: Original strand, 32189068 - 32189124
Alignment:
| Q |
283 |
attttcttggataaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||| |||| |||||||||||||||||| |||||||||||| | |||||| ||||| |
|
|
| T |
32189068 |
atttttttggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 294 - 342
Target Start/End: Complemental strand, 37372901 - 37372853
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagta |
342 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| |||||||| |
|
|
| T |
37372901 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagta |
37372853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 44508718 - 44508770
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
44508718 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
44508770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 1007226 - 1007179
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
1007226 |
taaaatatggttttagtccctccaaatatgcctcgttttgattttagt |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 1559702 - 1559655
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
1559702 |
taaaatatggttttagtccctgcaaatatgcctcgttttaattttagt |
1559655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 6108337 - 6108384
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
6108337 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
6108384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 10358004 - 10358051
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
10358004 |
taaaatatgatcttagtccctgcaaatatgcctcgttttggttttagt |
10358051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 12894399 - 12894352
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
12894399 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
12894352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 12932780 - 12932733
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
12932780 |
taaaatatgtttttggtccctgcaaatatgcctcgttttgattttagt |
12932733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 14739001 - 14738954
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
14739001 |
taaaatatggttttagtccctgcaaatatgcttcgttttgattttagt |
14738954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 17999718 - 17999671
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
17999718 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
17999671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 19561157 - 19561204
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
19561157 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 19757751 - 19757798
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
19757751 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19757798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 20388277 - 20388324
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
20388277 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
20388324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 20388672 - 20388625
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
20388672 |
taaaatatggttttagtcgctgaaaatatgcctcgttttgattttagt |
20388625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 21223408 - 21223455
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||| ||||||| |
|
|
| T |
21223408 |
taaaatatgattttagtccctgcaaatatgcttcgttttggttttagt |
21223455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 28911903 - 28911856
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
28911903 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
28911856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 30352901 - 30352854
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
30352901 |
taaaatatagttttagtccctgcaaatatgcctcgttttgattttagt |
30352854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 30709328 - 30709375
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||| ||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagt |
30709375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 30709641 - 30709594
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
30709641 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
30709594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 31503780 - 31503733
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
31503733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 44509051 - 44509004
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
44509051 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
44509004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 46304089 - 46304136
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
46304089 |
taaaatatgattttagttcctgcaaatatgcctcgttttggttttagt |
46304136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 294 - 340
Target Start/End: Complemental strand, 31732448 - 31732402
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttag |
340 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
31732448 |
taaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 294 - 340
Target Start/End: Original strand, 38186369 - 38186415
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttag |
340 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttag |
38186415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 1559346 - 1559391
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
1559346 |
taaaatatagttttagtccctgcaaatatgcctcgttttgatttta |
1559391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 8555796 - 8555751
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
8555796 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
8555751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 18311583 - 18311628
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||| |||||| ||||| |
|
|
| T |
18311583 |
taaaatatggttttagtctctacaaatatgcctcgttttggtttta |
18311628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 18891572 - 18891515
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||| ||||||||| |||||||| ||||||||||| || ||||| |||||||| |
|
|
| T |
18891572 |
tttttttggttaaaatatggttttagtccctgcaaatatgtctcgttttaattttagt |
18891515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 13769772 - 13769824
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
13769772 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
13769824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 16853591 - 16853539
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
16853591 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
16853539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 16941054 - 16941002
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||| ||||| ||||||| |
|
|
| T |
16941054 |
ttggataaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
16941002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 294 - 338
Target Start/End: Original strand, 17999468 - 17999512
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttt |
338 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| |||| |
|
|
| T |
17999468 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttt |
17999512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 39833238 - 39833186
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
39833238 |
ttggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
39833186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 48359077 - 48359025
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
48359077 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 54)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 46186412 - 46186459
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
46186412 |
taaaatatgattttagtccctgcaaatatgcctcgttttgattttagt |
46186459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 9863401 - 9863354
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
9863401 |
taaaatatggttttagtctctgcaaatatgcctcgttttggttttagt |
9863354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 10778373 - 10778420
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagt |
10778420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 20757403 - 20757450
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
20757450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 29445957 - 29446004
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29445957 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
29446004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 29955301 - 29955348
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
29955301 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
29955348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 30004455 - 30004502
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
30004455 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
30004502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 30268508 - 30268555
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
30268508 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
30268555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 45320976 - 45320929
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
45320976 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
45320929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 40169661 - 40169604
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||| ||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
40169661 |
tttttttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
40169604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 9261787 - 9261839
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
9261787 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
9261839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 15016386 - 15016438
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
15016386 |
ttggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
15016438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 294 - 346
Target Start/End: Original strand, 28942528 - 28942580
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagtatttg |
346 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |||| |
|
|
| T |
28942528 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagtttttg |
28942580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 275447 - 275494
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
275447 |
taaaatatggttttagtccctgcaactatgcctcgttttgattttagt |
275494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 3151753 - 3151800
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
3151753 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3151800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 3152108 - 3152061
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
3152108 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3152061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 3361815 - 3361768
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
3361815 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
3361768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 3830513 - 3830466
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
3830513 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3830466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 4513266 - 4513313
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
4513266 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4513313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 4950040 - 4950087
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
4950040 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4950087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 10976981 - 10977028
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
10976981 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10977028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 13584364 - 13584317
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
13584364 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
13584317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 19656544 - 19656591
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
19656544 |
taaaatatggttttagtccatgcaaatatgcctcgttttgattttagt |
19656591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 20612895 - 20612848
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
20612895 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
20612848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 21159456 - 21159503
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
21159456 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
21159503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 21159814 - 21159767
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
21159814 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
21159767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 22155932 - 22155979
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
22155932 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
22155979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 22156290 - 22156243
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
22156290 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22156243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 25610127 - 25610080
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
25610127 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
25610080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 25710867 - 25710820
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
25710867 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
25710820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 28427605 - 28427558
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
28427605 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
28427558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 30426223 - 30426177
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
30426223 |
taaaatatggttttagtc-ctgcaaatatgcctcgttttgattttagt |
30426177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 32119581 - 32119534
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
32119581 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
32119534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 37506870 - 37506917
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
37506870 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
37506917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 37507219 - 37507172
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
37507219 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
37507172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 38232244 - 38232291
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| || |||||||||||||| |
|
|
| T |
38232244 |
taaaatatgattttggtccctgcaaatatgtctcgttttgattttagt |
38232291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 39437106 - 39437059
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
39437106 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
39437059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 43440784 - 43440737
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
43440784 |
taaaatataattttagtccctgcaaatatgcctcgttttggttttagt |
43440737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 45002382 - 45002335
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
45002382 |
taaaatatggttttggtctctgcaaatatgcctcgttttggttttagt |
45002335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 50196302 - 50196349
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
50196302 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
50196349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 51834611 - 51834658
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
51834611 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
51834658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 52342580 - 52342533
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
52342580 |
taaaatatggtttttgtctctgcaaatatgcctcgttttggttttagt |
52342533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 294 - 340
Target Start/End: Original strand, 14633548 - 14633594
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttag |
340 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
14633548 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
14633594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 295 - 341
Target Start/End: Complemental strand, 21971046 - 21971000
Alignment:
| Q |
295 |
aaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
21971046 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagt |
21971000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 295 - 341
Target Start/End: Complemental strand, 21993482 - 21993436
Alignment:
| Q |
295 |
aaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
21993482 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagt |
21993436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 291 - 341
Target Start/End: Original strand, 36672963 - 36673013
Alignment:
| Q |
291 |
ggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||||| ||||||| |
|
|
| T |
36672963 |
ggataaaatatggttttggtctctgcaaatatgtcttgttttggttttagt |
36673013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 296 - 341
Target Start/End: Original strand, 25710515 - 25710560
Alignment:
| Q |
296 |
aaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
25710515 |
aaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
25710560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 296 - 341
Target Start/End: Complemental strand, 29955661 - 29955616
Alignment:
| Q |
296 |
aaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29955661 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29955616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 296 - 341
Target Start/End: Complemental strand, 30004816 - 30004771
Alignment:
| Q |
296 |
aaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
30004816 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
30004771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 39072210 - 39072165
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||||||| |
|
|
| T |
39072210 |
taaaatatggttttagttcctgcaaatatgcctcgttttgatttta |
39072165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 7957228 - 7957176
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||| | |||||| ||||||| |
|
|
| T |
7957228 |
ttggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagt |
7957176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 8510212 - 8510264
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
8510212 |
ttggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagt |
8510264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 22008892 - 22008840
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
22008892 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
22008840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 44802280 - 44802332
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||| | |||||| ||||||| |
|
|
| T |
44802280 |
ttggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagt |
44802332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 52)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 3679983 - 3679936
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
3679983 |
taaaatatgattttagtccctgcaaatatgcctcgttttgattttagt |
3679936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 45368846 - 45368799
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
45368846 |
taaaatatgattttagtctctgcaaatatgcctcgttttggttttagt |
45368799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 17984708 - 17984651
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
17984708 |
tttttttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
17984651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 294 - 347
Target Start/End: Original strand, 48955717 - 48955770
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagtatttgt |
347 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| ||||| |
|
|
| T |
48955717 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctttgt |
48955770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 52254481 - 52254429
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
52254481 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
52254429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 4323831 - 4323878
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
4323831 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
4323878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 15335292 - 15335245
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
15335245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 33234909 - 33234862
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
33234909 |
taaaatatgattttggtccctgcaaatatgcctcgttttgattttagt |
33234862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 35005447 - 35005494
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
35005447 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
35005494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 44641429 - 44641382
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
44641429 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
44641382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 49923815 - 49923768
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | |||||||||||||| |
|
|
| T |
49923815 |
taaaatatgattttggtctctgcaaatatgcttcgttttgattttagt |
49923768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 50429206 - 50429159
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
50429206 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
50429159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 7001904 - 7001847
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
7001904 |
tttttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
7001847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 35308113 - 35308061
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35308113 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35308061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 38136983 - 38136931
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
38136983 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
38136931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 45380638 - 45380586
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
45380638 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
45380586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 48956068 - 48956016
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
48956068 |
ttggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
48956016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 990376 - 990329
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
990376 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
990329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 1810930 - 1810977
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
1810930 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1810977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 3753216 - 3753263
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
3753216 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3753263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 7819100 - 7819053
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| |||||| ||||||| |
|
|
| T |
7819100 |
taaaatatggttttaatctctgcaaatatgcctcgttttggttttagt |
7819053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 11822007 - 11822054
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
11822007 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
11822054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 12158693 - 12158740
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | |||||| ||||||| |
|
|
| T |
12158693 |
taaaatatggttttagtctctgcaaatatgcatcgttttggttttagt |
12158740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 13770492 - 13770539
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
13770492 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
13770539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 18302384 - 18302337
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
18302384 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18302337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 18473275 - 18473322
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
18473275 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18473322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 18473592 - 18473545
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
18473592 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
18473545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 19721071 - 19721024
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
19721024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 22919687 - 22919734
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
22919687 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22919734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 22919974 - 22919927
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
22919974 |
taaaatatggttttagtctctgcaaatatgcctcgttttagttttagt |
22919927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 289 - 340
Target Start/End: Original strand, 24649348 - 24649399
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttag |
340 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
24649348 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttag |
24649399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 26061959 - 26062006
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
26061959 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
26062006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 26324588 - 26324635
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
26324588 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
26324635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 26324944 - 26324897
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
26324944 |
taaaatatgattttagtccatgcaaatatgcctcgttttggttttagt |
26324897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 27521579 - 27521626
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
27521579 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
27521626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 29072500 - 29072547
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29072500 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
29072547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 30323290 - 30323243
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
30323290 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
30323243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 32729046 - 32728999
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
32729046 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32728999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 33000308 - 33000355
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
33000308 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
33000355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 33379891 - 33379938
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
33379891 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
33379938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 35005741 - 35005694
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35005741 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35005694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 35056891 - 35056844
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35056891 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
35056844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 35307718 - 35307765
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35307718 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
35307765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 41358372 - 41358419
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
41358372 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
41358419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 44641081 - 44641128
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
44641081 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
44641128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 45368493 - 45368540
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
45368493 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
45368540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 296 - 341
Target Start/End: Complemental strand, 16083394 - 16083349
Alignment:
| Q |
296 |
aaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| |||||||| |||||||||| ||| |||||||||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagt |
16083349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 38151219 - 38151162
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
38151219 |
tttttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
38151162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 24653800 - 24653852
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
24653800 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
24653852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 26191357 - 26191409
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||| | |||||| ||||||| |
|
|
| T |
26191357 |
ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
26191409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 29072864 - 29072812
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| | |||| ||||||| |
|
|
| T |
29072864 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagt |
29072812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 40718476 - 40718424
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||| | |||||||||||||| |
|
|
| T |
40718476 |
ttggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagt |
40718424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 40)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 41694005 - 41693953
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
41694005 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
41693953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 23989841 - 23989888
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
23989841 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
23989888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 29865224 - 29865271
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29865224 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
29865271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 44073804 - 44073757
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
44073804 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
44073757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 284 - 341
Target Start/End: Original strand, 1497603 - 1497660
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||| ||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
1497603 |
tttttttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagt |
1497660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 26239167 - 26239110
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||| || ||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
26239167 |
ttttctaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
26239110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 45442319 - 45442364
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
45442319 |
taaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 283 - 339
Target Start/End: Complemental strand, 33733249 - 33733193
Alignment:
| Q |
283 |
attttcttggataaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||| |||| ||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
33733249 |
attttattggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
33733193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 34317796 - 34317848
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
34317796 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
34317848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 3671006 - 3671053
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3671006 |
taaaatatggttttagtccatgcaaatatgcctcgttttgattttagt |
3671053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 7814734 - 7814687
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
7814734 |
taaaatatgattttagtccctgcaaatatgcctcattttggttttagt |
7814687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 10374777 - 10374824
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
10374777 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10374824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 12835328 - 12835375
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
12835328 |
taaaatatgattttagtccctgcaaatatgcctcattttggttttagt |
12835375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 16900203 - 16900156
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
16900203 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16900156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 16993594 - 16993547
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
16993594 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16993547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 17912452 - 17912499
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
17912499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 19184148 - 19184101
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
19184148 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19184101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 22881616 - 22881663
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
22881616 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22881663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 24483888 - 24483841
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
24483888 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
24483841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 25954423 - 25954376
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagt |
25954376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 26238816 - 26238863
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
26238863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 26814226 - 26814179
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
26814226 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
26814179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 31225718 - 31225765
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
31225718 |
taaaatatagttttagtccctgcaaatatgcctcgttttgattttagt |
31225765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 33732865 - 33732912
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
33732865 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
33732912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 37271742 - 37271789
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
37271742 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
37271789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 37272099 - 37272052
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
37272099 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
37272052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 38980250 - 38980203
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
38980250 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
38980203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 42358702 - 42358749
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
42358749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 43788861 - 43788908
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
43788861 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
43788908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 44985624 - 44985671
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
44985624 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
44985671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 283 - 341
Target Start/End: Complemental strand, 5790907 - 5790849
Alignment:
| Q |
283 |
attttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||| |||| ||||||||| |||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
5790907 |
attttattggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
5790849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 296 - 341
Target Start/End: Complemental strand, 3671187 - 3671142
Alignment:
| Q |
296 |
aaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
3671187 |
aaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3671142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 284 - 341
Target Start/End: Original strand, 23732032 - 23732089
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||||||||| || ||||||||||| || |||||| ||||||| |
|
|
| T |
23732032 |
ttttcttggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
23732089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 32691316 - 32691361
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
32691316 |
taaaatatggttttagtttctgcaaatatgcctcgttttggtttta |
32691361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 5334749 - 5334801
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
5334749 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
5334801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 11713483 - 11713535
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
11713483 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
11713535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 26813864 - 26813916
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
26813864 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
26813916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 29859485 - 29859537
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
29859485 |
ttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
29859537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 34318085 - 34318033
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| || ||||||||||| |||||||||||||| |
|
|
| T |
34318085 |
ttggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagt |
34318033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 38231429 - 38231481
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||||||||||||| || |||||||||| ||| |||||||||||||| |
|
|
| T |
38231429 |
ttggctaaaatatgattttgatccctgcaaatataccttgttttgattttagt |
38231481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 8550 - 8597
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
8550 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
8597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 12533 - 12486
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
12533 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
12486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000005; HSPs: 35)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 33526409 - 33526362
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
33526409 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
33526362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 10755525 - 10755480
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
10755525 |
taaaatatggttttagtccctgcaaatatgcctcgttttgatttta |
10755480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 38930661 - 38930616
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
38930661 |
taaaatatgattttagtccctgcaaatatgcctcgttttggtttta |
38930616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 44997934 - 44997979
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
44997934 |
taaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 10776501 - 10776449
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
10776501 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
10776449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 10873282 - 10873230
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| |||||||||||||||||| |||||| ||||||| |
|
|
| T |
10873282 |
ttggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagt |
10873230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 293 - 341
Target Start/End: Complemental strand, 28497617 - 28497569
Alignment:
| Q |
293 |
ataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
28497617 |
ataaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
28497569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 1162912 - 1162959
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
1162912 |
taaaatatggttttagtccctgcaaatatgcttcgttttgattttagt |
1162959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 1525812 - 1525859
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
1525812 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1525859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 1685117 - 1685164
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
1685164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 5357426 - 5357473
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
5357426 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagt |
5357473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 8094482 - 8094529
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||||| ||||||| |
|
|
| T |
8094482 |
taaaatatggttttagtctctgcaaatatgtctcgttttggttttagt |
8094529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 14239077 - 14239030
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
14239077 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
14239030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 14495072 - 14495119
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
14495072 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
14495119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 16643664 - 16643711
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
16643664 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
16643711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 16789366 - 16789319
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
16789366 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
16789319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 19494410 - 19494363
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
19494410 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19494363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 22650467 - 22650514
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
22650467 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
22650514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 22917567 - 22917614
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
22917567 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
22917614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 24187894 - 24187847
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
24187894 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
24187847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 25131452 - 25131397
Alignment:
| Q |
286 |
ttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| ||||||||| ||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
25131452 |
ttcttggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagt |
25131397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 27341588 - 27341541
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
27341588 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
27341541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 32418321 - 32418368
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
32418321 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
32418368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 33652193 - 33652240
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||| ||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagt |
33652240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 43477166 - 43477213
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
43477166 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
43477213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 43727098 - 43727145
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
43727098 |
taaaatatggttttagtccctgcaaatatgcattgttttgattttagt |
43727145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 283 - 341
Target Start/End: Complemental strand, 35097700 - 35097642
Alignment:
| Q |
283 |
attttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||| |||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
35097700 |
atttttttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
35097642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 4016908 - 4016953
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
4016908 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4016953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 4375695 - 4375740
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
4375695 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
4375740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 347
Target Start/End: Complemental strand, 5357760 - 5357707
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagtatttgt |
347 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| | |||||| ||||||| ||||| |
|
|
| T |
5357760 |
taaaatatgattttggtccctgcaaatatgcttcgttttggttttagtctttgt |
5357707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 2728599 - 2728547
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||| ||| |||||||||||||| |||||| ||||||| |
|
|
| T |
2728599 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
2728547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 7272753 - 7272701
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||| | |||||||||||||| |||||| ||||||| |
|
|
| T |
7272753 |
ttggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagt |
7272701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 294 - 326
Target Start/End: Complemental strand, 21509915 - 21509883
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcct |
326 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
21509915 |
taaaatatgattttagtccctgcaaatatgcct |
21509883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Complemental strand, 40066822 - 40066770
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
40066822 |
ttggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagt |
40066770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 40844154 - 40844206
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||| | |||||| ||||||| |
|
|
| T |
40844154 |
ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagt |
40844206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000005; HSPs: 30)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 1890449 - 1890402
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
1890449 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
1890402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 15962394 - 15962339
Alignment:
| Q |
286 |
ttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
15962394 |
ttcttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
15962339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 22822648 - 22822601
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
22822648 |
taaaatatggttttagtccctgcaaatatgcctcgttttgattttagt |
22822601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 30929041 - 30928994
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
30929041 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagt |
30928994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 34989964 - 34990011
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
34989964 |
taaaatatgcttttagtccctgcaaatatgcctcgttttgattttagt |
34990011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 283 - 341
Target Start/End: Original strand, 494397 - 494455
Alignment:
| Q |
283 |
attttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||| |||| ||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
494397 |
atttttttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
494455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 31167207 - 31167150
Alignment:
| Q |
284 |
ttttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| |||| ||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
31167207 |
tttttttggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagt |
31167150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 18024009 - 18024061
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||| |||||| ||||||| |
|
|
| T |
18024009 |
ttggataaaatatggttttggtctttgcaaatatgcctcgttttggttttagt |
18024061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 294 - 342
Target Start/End: Original strand, 22822310 - 22822358
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagta |
342 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
22822310 |
taaaatatggttttagtctctgcaaatatacctcgttttggttttagta |
22822358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 1890062 - 1890109
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagt |
1890109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 3356495 - 3356448
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
3356448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 6412576 - 6412529
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
6412576 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttagt |
6412529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 7156157 - 7156110
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
7156157 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
7156110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 8680778 - 8680825
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
8680778 |
taaaatatgtttttagtccctgcaaatatgcctcgttttggttttagt |
8680825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 8681113 - 8681066
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
8681113 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
8681066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 11448540 - 11448587
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || |||||| ||||||| |
|
|
| T |
11448540 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagt |
11448587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 15076201 - 15076154
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
15076201 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
15076154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 24274128 - 24274081
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
24274128 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
24274081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 26376042 - 26375995
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
26375995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 31166873 - 31166920
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
31166873 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
31166920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 33131847 - 33131800
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
33131847 |
taaaatatggttttagtctttgcaaatatgcctcgttttggttttagt |
33131800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 33801740 - 33801693
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
33801740 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
33801693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 33808623 - 33808670
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
33808623 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagt |
33808670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 34582532 - 34582579
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
34582532 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
34582579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 295 - 341
Target Start/End: Original strand, 543365 - 543411
Alignment:
| Q |
295 |
aaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
543411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 289 - 339
Target Start/End: Complemental strand, 19296409 - 19296359
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
19296409 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
19296359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 543721 - 543676
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||| ||||| |
|
|
| T |
543721 |
taaaatatgattttagtccctgcaaatatgctttgttttggtttta |
543676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 289 - 338
Target Start/End: Complemental strand, 11129545 - 11129496
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgatttt |
338 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||||||| |||||| |||| |
|
|
| T |
11129545 |
ttggctaaaatatgattttactccctgcaaatatgcctcgttttggtttt |
11129496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 294 - 338
Target Start/End: Complemental strand, 2616237 - 2616193
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttt |
338 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| |||| |
|
|
| T |
2616237 |
taaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 341
Target Start/End: Original strand, 11925737 - 11925789
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||| ||| |||||||||| ||| ||||||||||| || |||||||||||||| |
|
|
| T |
11925737 |
ttggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagt |
11925789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 33; Significance: 0.000000003; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 281 - 341
Target Start/End: Complemental strand, 10525 - 10465
Alignment:
| Q |
281 |
tgattttcttggataaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||| | || ||||||||| |||||||| ||||||||||| ||||||||| ||||||| |
|
|
| T |
10525 |
tgattttataggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagt |
10465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 10171 - 10218
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
10171 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
10218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 2781 - 2828
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
2781 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
2828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 1641 - 1594
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
1641 |
taaaatatgaatttagtccctgcaaatatgcctcgttttggttttagt |
1594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 8735 - 8782
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
8735 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
8782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 9025 - 8978
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
9025 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
8978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 14700 - 14747
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
14700 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
14747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 8333 - 8380
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
8333 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 8639 - 8592
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
8639 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagt |
8592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Original strand, 5402 - 5449
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
5402 |
taaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
5449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 294 - 341
Target Start/End: Complemental strand, 366270 - 366223
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgattttagt |
341 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
366270 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
366223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 5212 - 5257
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
5212 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 5232 - 5277
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||| ||||| |
|
|
| T |
5232 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
5277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 7261 - 7216
Alignment:
| Q |
294 |
taaaatatgattttagtctctgcaaatatgcctggttttgatttta |
339 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||| ||||| |
|
|
| T |
7261 |
taaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 289 - 333
Target Start/End: Complemental strand, 4314 - 4270
Alignment:
| Q |
289 |
ttggataaaatatgattttagtctctgcaaatatgcctggttttg |
333 |
Q |
| |
|
|||| ||||||||| |||||||| |||||||||||||| |||||| |
|
|
| T |
4314 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
4270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University