View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6546_low_12 (Length: 381)
Name: NF6546_low_12
Description: NF6546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6546_low_12 |
 |  |
|
| [»] scaffold0136 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 21145499 - 21145137
Alignment:
| Q |
1 |
attatgtcatttttt-caaattattatccgtgtc-ggtatatcagtgtccgtgttagcatctagatggggcccactttttcatacactcattgaacacct |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| || |||||||||||| ||||||| ||| |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
21145499 |
attatgtcatttttttcaaattattatccgtgtcaggcatatcagtgtccatgttagcgtctgtatggggcc-actttttcatacactcatcgaacacct |
21145401 |
T |
 |
| Q |
99 |
caatttatctatgtatctcttcctaatcctaccacatctatcaaa----taactcatttctttctcttcattttattttaaggtgtacacgcccccacat |
194 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
21145400 |
caatttatctatatatctcttcctaatcctaccacatctatcaaaaaactaactcatttctttctcttcatttta-----aggtgtatacacccccacat |
21145306 |
T |
 |
| Q |
195 |
ggggtgtacactaaactaaacaaaacatttttcttgttattttgatgctatgaaatggactgagaacagagaaaacaagtccaacaacagtgagtccata |
294 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21145305 |
ggggtgtacactaaactaaactaaacatttttcttgttattttgatgctatgaaatggaatgagaacagagaaaacaagtccaacaacagtgagtccata |
21145206 |
T |
 |
| Q |
295 |
aaagcagcagaaaagtggtaaattataaacatgagtagtaacgacgattggaacaaatgaagggtttgt |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
21145205 |
aaagcagcagaaaagtggtaaattataaacatgagtagtaatgacgtttggaacaaatgaagggtttgt |
21145137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 22794105 - 22794136
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgt |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22794105 |
attatgtcattttttcaaattattatccgtgt |
22794136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 40747800 - 40747835
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggt |
36 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40747800 |
attatgtcattttctcaaattattatccgtgtcggt |
40747835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 42004974 - 42005006
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtc |
33 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
42004974 |
attatgtcattttctcaaattattatccgtgtc |
42005006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 43250025 - 43249974
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
43250025 |
attatgtcattttctcaaattattatccgtgtcggcgtgtcagtgtccgtgt |
43249974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 11061103 - 11061154
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||| ||||||||||||||||| | |||||||| | ||||||||||||| |
|
|
| T |
11061103 |
attatgtgattttttcaaattattagctgtgtcggtgtgtcagtgtccgtgt |
11061154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 13427608 - 13427575
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcg |
34 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
13427608 |
attatgtcattttttcaaattattttccgtgtcg |
13427575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 44021007 - 44020970
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtat |
38 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
44021007 |
attatgtaattttttcaaattattatccgtgtctgtat |
44020970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 24205068 - 24205119
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
24205068 |
attatgtcattttctcaaattattatccgtgtcggcgtgtcagtgtccgtgt |
24205119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 12704684 - 12704715
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgt |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12704684 |
attatgtcattttttcaaattattatccgtgt |
12704715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 25948914 - 25948965
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||| ||||||||||||||||| |||| |||| || ||||||||||||| |
|
|
| T |
25948914 |
attatgtgattttttcaaattattagccgtatcggcatgtcagtgtccgtgt |
25948965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 15864865 - 15864831
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcgg |
35 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15864865 |
attatatcattttttcaaattattatccgtgtcgg |
15864831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 32910583 - 32910533
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtg |
51 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| || |||| |||| |
|
|
| T |
32910583 |
attatgtcattttctcaaattattatccgtgtcggtatgtcggtgttcgtg |
32910533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 21945535 - 21945484
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| || |||||||| |||| |
|
|
| T |
21945535 |
attatgtcattttttcaaattattagctgtgtcggcatgtcagtgtctgtgt |
21945484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 20743305 - 20743339
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcgg |
35 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20743305 |
attatgtcattttctcaaattattatccgtgtcgg |
20743339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 46971928 - 46971977
Alignment:
| Q |
3 |
tatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
46971928 |
tatgtcattatctcaaattattatccgtgtcggagtatcagtatccgtgt |
46971977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 37203296 - 37203264
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtc |
33 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
37203296 |
attatgtcattttttcaaattattagccgtgtc |
37203264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 11308031 - 11308080
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtg |
51 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||| |||| |
|
|
| T |
11308031 |
attatgtcattttttcaaatta-tatccgtgtcggtatatcggtgttcgtg |
11308080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 30404877 - 30404928
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| | ||||||||||||| |
|
|
| T |
30404877 |
attatgtgattttttcaaattattaaccgtgtcggcgtgtcagtgtccgtgt |
30404928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 25317169 - 25317136
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcg |
34 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
25317169 |
attatgtcattttttcaaattattatcggtgtcg |
25317136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 30563441 - 30563408
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcg |
34 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
30563441 |
attatgtcattttctcaaattattatccgtgtcg |
30563408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0136
Description:
Target: scaffold0136; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 3876 - 3927
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||| ||||||| ||||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
3876 |
attatgtgatttttttaaattattaaccgtgtcggcatatcagtgtctgtgt |
3927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 225295 - 225346
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| | ||||||||||||| |
|
|
| T |
225295 |
attatgtcattttctcaaattattatctgtgtcggcgtgtcagtgtccgtgt |
225346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 44067548 - 44067497
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | |||||||| |||| |
|
|
| T |
44067548 |
attatgtcattttctcaaattattatccgtgtcggcgtgtcagtgtcggtgt |
44067497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 28883905 - 28883955
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtg |
51 |
Q |
| |
|
||||||||||||| |||||||||||| |||| ||| || |||||||||||| |
|
|
| T |
28883905 |
attatgtcattttctcaaattattattcgtggcggcatgtcagtgtccgtg |
28883955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 30068055 - 30068087
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtc |
33 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
30068055 |
attatgtcattttctcaaattattatccgtgtc |
30068087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 21191083 - 21191134
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgt |
52 |
Q |
| |
|
||||||| ||||||||||||||||| | ||||||| || ||||||||||||| |
|
|
| T |
21191083 |
attatgtgattttttcaaattattagctgtgtcggcatgtcagtgtccgtgt |
21191134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 38749590 - 38749623
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcg |
34 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
38749590 |
attatgtcattttttcaaattattatcggtgtcg |
38749623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 4344774 - 4344742
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtc |
33 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
4344774 |
attatgtcattttttcaaattattatcggtgtc |
4344742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 19579733 - 19579681
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtcggtatatcagtgtccgtgtt |
53 |
Q |
| |
|
||||||| ||||| ||||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
19579733 |
attatgtgattttctcaaattattagctgtgtcggcgtatcagtgtccgtgtt |
19579681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 3 - 35
Target Start/End: Complemental strand, 42469251 - 42469219
Alignment:
| Q |
3 |
tatgtcattttttcaaattattatccgtgtcgg |
35 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
42469251 |
tatgtcattttctcaaattattatccgtgtcgg |
42469219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 5 - 38
Target Start/End: Complemental strand, 34229482 - 34229449
Alignment:
| Q |
5 |
tgtcattttttcaaattattatccgtgtcggtat |
38 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
34229482 |
tgtcattttttcaaattattatccatgtcggtat |
34229449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 28715327 - 28715295
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtc |
33 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
28715327 |
attatgtcattttttcaaattattagccgtgtc |
28715295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 34446597 - 34446565
Alignment:
| Q |
1 |
attatgtcattttttcaaattattatccgtgtc |
33 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
34446597 |
attatgtcattttctcaaattattatccgtgtc |
34446565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University