View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6546_low_21 (Length: 273)
Name: NF6546_low_21
Description: NF6546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6546_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 52824496 - 52824640
Alignment:
| Q |
18 |
acaatccctcccaattaacattgtcacatcttattata--tatatatcaacaatgatatagacatatctttagatttcatacattcattcaacatctgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824496 |
acaatccctcccaattaacattgtcacatcttattatatatatatatcaacaatgatatagacatatctttagatttcatacattcattcaacatctgat |
52824595 |
T |
 |
| Q |
116 |
tttctctctagcactcttcttttcacatcatcaaactatcatatc |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52824596 |
tttctctctagcactcttcttttcacatcatcaaactgtcatatc |
52824640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 207 - 273
Target Start/End: Original strand, 52824696 - 52824763
Alignment:
| Q |
207 |
agatgtatacactacaggg-tgtacacaaaacgttgatgtagctctagtatgaatattttgtttgttt |
273 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52824696 |
agatgtatacactacaggggtgtacacaaaacgttgatgtagctctagtatgaatattttgtttgttt |
52824763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University