View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6546_low_23 (Length: 258)
Name: NF6546_low_23
Description: NF6546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6546_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 63814 - 64041
Alignment:
| Q |
16 |
atctcaattgactcaccaactcatatcttaaataggagtacccatgtctggcctgtggattaagattcatgcctgtatatggcccatatgggtcacctta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
63814 |
atctcaattgactcaccaactcatatcttaaataggagtacccatgtctggcctttggattaagattcatgcctgtatatggcccatatgggtcacctta |
63913 |
T |
 |
| Q |
116 |
tattggttgtttaatcgttttctcaacgaaaaaatgaatagtaatggtttagttccaaaaggtttcttctgtacaccgtgtggttcaactcataacacgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
63914 |
tattggttgtttaatcgttttctcaacgaaaaaatgaatagtaatggtttagttccaaaaggtttcttctgtacaccgtgcggttcaactcataacacgt |
64013 |
T |
 |
| Q |
216 |
attaagacatgtactatagattgaaagt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
64014 |
attaagacatgtactatagattgaaagt |
64041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University