View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6546_low_31 (Length: 239)
Name: NF6546_low_31
Description: NF6546
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6546_low_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 28 - 239
Target Start/End: Complemental strand, 3055890 - 3055679
Alignment:
| Q |
28 |
ttttccgtgtaggaagagcattctattcacaacctttacatttatgggacnnnnnnnccaacactctcacaagtttcaccacacgtttttcttttacaat |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3055890 |
ttttccgtgtaggaagagcattctattcacaacctttacatttatgggacaaaaaaaccaacactctcacaagtttcaccacacgtttttcttttacaat |
3055791 |
T |
 |
| Q |
128 |
tgataaactaaatgacactacatacggtgacggttttgtgttttacttggcacctttaggttatcaaataccacctaattcagctggtggtgtttatggt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3055790 |
tgataaactaaatgacactacatacggtgatggttttgtgttttacttggcacctttaggttatcaaataccacctaattcagctggtggtgtttatggt |
3055691 |
T |
 |
| Q |
228 |
ctttttaatgct |
239 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3055690 |
ctttttaatgct |
3055679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University