View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6547_high_14 (Length: 363)
Name: NF6547_high_14
Description: NF6547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6547_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 17 - 356
Target Start/End: Original strand, 2734721 - 2735060
Alignment:
| Q |
17 |
atatctagtctaagcatcattcaagattcggctaagtccattccatcatcgatatcttgtgctagcaagaacccgattgactcatcttttgcgacaatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2734721 |
atatctagtctaagcatcattcaagattcgactaagtccattccatcatcgatatcttgtgctagcaagaacccgattgactcatcttttgcgacaatgt |
2734820 |
T |
|
| Q |
117 |
acatttttaccggtttacctggtactagcggcacgagtactggtggattcacaaaggcatacttgatttgcttaaaggtgttatgttttcggctccccat |
216 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2734821 |
acaactttaccggtttacctggtactagtggcacgagtactggtggattcacaaaggcctacttgatttgcttaatggtgttatgttttcggctccccat |
2734920 |
T |
|
| Q |
217 |
atcattccctctaagtcctttagtcttagcaatggtgaaaatgacttcatcttgccaatcaaattagatatgaaccttcttaggaaacttattttccccg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2734921 |
atcattccctctaagtcctttagtcttaacaaaggtgaaaatgacttcatcttgccaatcaaattagatatgaaccttcttaggaaacttattttccccg |
2735020 |
T |
|
| Q |
317 |
tagagactctgcaacttcttctttgtgccttgttcatctc |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2735021 |
tagagactctgcaacttcttctttgtgccttgttcttctc |
2735060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University