View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6547_low_19 (Length: 339)
Name: NF6547_low_19
Description: NF6547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6547_low_19 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 93 - 339
Target Start/End: Complemental strand, 30877286 - 30877048
Alignment:
| Q |
93 |
gcacaactatcagacaatttaatgagctctagtattttcattaacatcacagattcacagctctatgagcaagccgttttaaaatattcttaatcattat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30877286 |
gcacaactatcagacaatttaatgagctctagtattttcattaacatcacaa--------ctctatgagcaagccattttaaaatattcttaatcattat |
30877195 |
T |
 |
| Q |
193 |
atgaactttgaaattgaaactttatgaaaataaaatgatgatagaattaacaattgttctattagttttagattcgcccaaaatctttattttaatatcc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
30877194 |
atgaactttgaaattgaaactttatgaaaataaaatgatgatagaattaacaattgttctattagttttagattcgcccaaaatctttattttaataccc |
30877095 |
T |
 |
| Q |
293 |
gatgattaaaagttgatagaaatgattctaaactaagctggctgaaa |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877094 |
gatgattaaaagttgatagaaatgattctaaactaagctggctgaaa |
30877048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 16 - 49
Target Start/End: Complemental strand, 30877363 - 30877330
Alignment:
| Q |
16 |
ataccatcgcatataggttccaagttctttatac |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30877363 |
ataccatcgcatataggttccaagttctttatac |
30877330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University