View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6547_low_24 (Length: 294)
Name: NF6547_low_24
Description: NF6547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6547_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 258
Target Start/End: Complemental strand, 38375331 - 38375086
Alignment:
| Q |
13 |
aaaataaaacatttgtctaaacgcatgagtaccttaatatataattaaaaccaaaattggtatcaccctaactatttaccgatactattaaaagactacg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38375331 |
aaaataaaacatttgtctaaacgcatgagtaccttaatatataattaaaaccaaaattggtatcaccctaactatttaccgatactattaaaaaactacg |
38375232 |
T |
 |
| Q |
113 |
gcgtacctcgaaacatttatgctttcttttacatactttttattttcaaagattgtataaaatgatacataatttttagaggtgatgtatttaggagaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38375231 |
gcgtacctcgaaacatttatgctttcttttacatactttttattttcaagtattgtataaaatgatacataatttttagaggtgatgtatttaggagaat |
38375132 |
T |
 |
| Q |
213 |
catattgcattacaaggtttacactctttgtatgagtttcttatat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38375131 |
catattgcattacaaggtttacactctttgtatgagtttcttatat |
38375086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University