View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6547_low_28 (Length: 266)
Name: NF6547_low_28
Description: NF6547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6547_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 5 - 248
Target Start/End: Complemental strand, 35071696 - 35071454
Alignment:
| Q |
5 |
gttagataaagcacctacgtgttgatgtccaccacacatgtgattctacggaattatgttatttttcaattattattgatgtccatgtatgtaatccgta |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
35071696 |
gttagataaagcacctacgtgttgatgtccaccacacatgtgattctacggaattatgttatttttcaattattattaatgtccatgtatgta-tccgta |
35071598 |
T |
|
| Q |
105 |
cttcatagattaattggtttgtataaaaatggaggagatttcaggtcacaggaatgacattggtcaccggatctgaaatcaacggtgtcttgtaaaattc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35071597 |
cttcatagattaattggtttgtataaaaatggaggagatttcaggtcacgagaatgacattggtcaccggatctgaaatcaactgtgtcttgtaaaattc |
35071498 |
T |
|
| Q |
205 |
tgttctatgcttttcattaaaactgaagctcaatcttgagattt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35071497 |
tgttctatgcttttcattaaaactgaagcacaatcttgagattt |
35071454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University