View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6547_low_30 (Length: 252)
Name: NF6547_low_30
Description: NF6547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6547_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 85
Target Start/End: Original strand, 33381782 - 33381849
Alignment:
| Q |
18 |
agttttaacgagattcaatgcattaatgctgctatgatcataccttgttaaccggttgttctcttgta |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33381782 |
agttttaacgagattcaatgcattaatgctgctatgatcataccttgttaaccggttgttctcttgta |
33381849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 150 - 244
Target Start/End: Original strand, 33381896 - 33381990
Alignment:
| Q |
150 |
ttttaacttttattacatttacacctattaattgacagcnnnnnnnnnnnncaaatagcttgttagatgttatataataaaccgaacttcatctc |
244 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33381896 |
ttttaacttttattacatttacacttattaattgacagcaaaaagaaaaaactaatagcttgttagatgttatataataaaccgaacttcatctc |
33381990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University