View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6547_low_33 (Length: 251)
Name: NF6547_low_33
Description: NF6547
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6547_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 230
Target Start/End: Original strand, 1750854 - 1751074
Alignment:
| Q |
10 |
attattcttgatacttttgggacattttctttaaatgtgaatagcatagctcttctcataatcgtttggacggtagatgaaagataaattcatttaaata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1750854 |
attattcttgatacttttgggacattttctttcaatgtgaatagcatagctcttctcataatcgtttggactgtagatgaaagataaattcatttaaata |
1750953 |
T |
 |
| Q |
110 |
attgaacatataaagcaaacccaccacgcatactcattatcaattaaaagcttgccaaacccttattttcctagggatttttcttttcttctctcagctt |
209 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1750954 |
attgaacatataaagcaaacgcaccacgcatactcattatcaattaaaagcttgccaaacccttattttcctagggatttttcttttcttctctcagctt |
1751053 |
T |
 |
| Q |
210 |
atgaacaatgaacatgattgt |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1751054 |
atgaacaatgaacatgattgt |
1751074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 10 - 55
Target Start/End: Original strand, 19661286 - 19661331
Alignment:
| Q |
10 |
attattcttgatacttttgggacattttctttaaatgtgaatagca |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
19661286 |
attattcttgatacttttgggacattttctttcgctgtgaatagca |
19661331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University