View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6548_high_12 (Length: 346)
Name: NF6548_high_12
Description: NF6548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6548_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 169 - 331
Target Start/End: Complemental strand, 25325771 - 25325607
Alignment:
| Q |
169 |
aacaatacatg--ttacattttccaccaaaaacaaaaatagcctaatcaatatttttcaaaactccgtctttctcgaattcattgttgttccaaacatgc |
266 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25325771 |
aacaatacatgaattatattttccaccaaaaacaaaaatagcctaatcaatatttttcaaaactccgtctttctcgaattcattgttgttccaaacatgc |
25325672 |
T |
 |
| Q |
267 |
atagtgccctaactcagtttgaatatagttatctaacaataaattgttatgtcgactattgttct |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
25325671 |
atagtgccctaactcagtttgaatatagttgtctaacaataaattgttttgtcgactattgttct |
25325607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University