View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6548_high_27 (Length: 261)
Name: NF6548_high_27
Description: NF6548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6548_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 44343557 - 44343803
Alignment:
| Q |
1 |
ttcttttttgaaattaaaggaccgttggtgtctgtctttattattttattagtttgggttccatgcatggttatactttcaaacatgttcctaatcctcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44343557 |
ttcttttttgaaattaaaggaccgttggtgtctgtctttattattt-attagtttgggttgcatgcatggttatactttcaaacatgttcctaatcctc- |
44343654 |
T |
|
| Q |
101 |
atcttaggcctactctgattcttgtag---attggggacagacatccgaatatatattaggaatctgcctgctgtcggtgtataagttggtctcatcaac |
197 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
44343655 |
---ttaggcctactcggattcttgtagtagattggggacagacatccgaatatatattaggaatctgcgtgctgtctgtgtataagttggtctcatcaac |
44343751 |
T |
|
| Q |
198 |
gatctaactatccttaacactccctctctcacactatcttcatcactgtttc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44343752 |
gatctaactatccttaacactccctctctcacactatcttcatcactgtttc |
44343803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 257
Target Start/End: Original strand, 25865345 - 25865390
Alignment:
| Q |
213 |
aacactcc-ctctctcacactatcttcatcactgtttcatctctct |
257 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
25865345 |
aacactcctctctctcacacaatcttcatcactgtttcttctctct |
25865390 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University