View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6548_low_2 (Length: 717)
Name: NF6548_low_2
Description: NF6548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6548_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 3e-99; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 3e-99
Query Start/End: Original strand, 515 - 702
Target Start/End: Original strand, 1273922 - 1274109
Alignment:
| Q |
515 |
ggtgtgtttccaataatataatatctttgtcccttagtacatatttgtctttgcatctcaataaactcaatataaaataatctttatattattgacctta |
614 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1273922 |
ggtgtgtttccaataatataatatctttgtcccttagtacatatttgtctttgcatctcaataaactctatataaaataatctttatattattgacctta |
1274021 |
T |
|
| Q |
615 |
ttgattgcattgattacattcacctgtatagtacctttttcctgttttggtctctttctctcactttgatgaattcatagaaattatt |
702 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1274022 |
ttgattgcattgattacattcacctgtatagtacctttttcctgttttggtctctttctctcactttgatgaattcatagaaattatt |
1274109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 2e-45
Query Start/End: Original strand, 316 - 433
Target Start/End: Original strand, 1273723 - 1273840
Alignment:
| Q |
316 |
caagatgtttgattgtctatataaatttacacgtgattatttattagatctaatcactagagatgactacataataaaaaataaatttacaaaaatactc |
415 |
Q |
| |
|
||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
1273723 |
caagatgtttgattgtccgtataaatttagaggtgattatttattagatctaatcactagagatgactgcataataaaaaataaatttacaaaaataccc |
1273822 |
T |
|
| Q |
416 |
tctaatcatacttccttc |
433 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
1273823 |
tctaatcatacttccttc |
1273840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 18 - 105
Target Start/End: Original strand, 1273596 - 1273683
Alignment:
| Q |
18 |
catatcatgccttttttcgtgtcatccatcaatcttaaaataagtgtttgtgtatatccgtaaaatatctcatacgtatccaacaaaa |
105 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
1273596 |
catatcttgcctttttttgtgtcatccatcaatcttaaaataagtgtttgtgtatatccgtaaagtatctcatacgtatccaataaaa |
1273683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University