View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6548_low_25 (Length: 285)
Name: NF6548_low_25
Description: NF6548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6548_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 10748700 - 10748494
Alignment:
| Q |
1 |
tcctgaaatagtttttcaaaataaagaatagaggaaccaaaggagcaaccatcagtatttaaaacatgaccctaagttgatccggccatgagatggtctc |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10748700 |
tcctgtaatagtttttcaaaataaagaatagaggaaccaaaggagcaaccatcagtatttaaaacatgaccctaagttgatccggccatgagatggtctc |
10748601 |
T |
 |
| Q |
101 |
atctcattattagtttatttatttgtataatatagtaaaataaaatatagaccttgttttatcaa-ggtgtgtttagattgatggtttagagggaggggg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10748600 |
atctcattattagtttatttatttgtataatatagtaaaataaaatatagaccttgttttatcaagggtgtgtttagattgatggtttagagggaggggg |
10748501 |
T |
 |
| Q |
200 |
gtgttac |
206 |
Q |
| |
|
||||||| |
|
|
| T |
10748500 |
gtgttac |
10748494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 218 - 276
Target Start/End: Complemental strand, 10748479 - 10748421
Alignment:
| Q |
218 |
aaattacggagtatataacatgnnnnnnnaaaataaattaagtatgatagaagtattat |
276 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| ||||||||| |
|
|
| T |
10748479 |
aaattacggagtatataacatgtttttctaaaataaattaagtgtgataaaagtattat |
10748421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University