View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6548_low_25 (Length: 285)

Name: NF6548_low_25
Description: NF6548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6548_low_25
NF6548_low_25
[»] chr3 (2 HSPs)
chr3 (1-206)||(10748494-10748700)
chr3 (218-276)||(10748421-10748479)


Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 10748700 - 10748494
Alignment:
1 tcctgaaatagtttttcaaaataaagaatagaggaaccaaaggagcaaccatcagtatttaaaacatgaccctaagttgatccggccatgagatggtctc 100  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10748700 tcctgtaatagtttttcaaaataaagaatagaggaaccaaaggagcaaccatcagtatttaaaacatgaccctaagttgatccggccatgagatggtctc 10748601  T
101 atctcattattagtttatttatttgtataatatagtaaaataaaatatagaccttgttttatcaa-ggtgtgtttagattgatggtttagagggaggggg 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
10748600 atctcattattagtttatttatttgtataatatagtaaaataaaatatagaccttgttttatcaagggtgtgtttagattgatggtttagagggaggggg 10748501  T
200 gtgttac 206  Q
    |||||||    
10748500 gtgttac 10748494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 218 - 276
Target Start/End: Complemental strand, 10748479 - 10748421
Alignment:
218 aaattacggagtatataacatgnnnnnnnaaaataaattaagtatgatagaagtattat 276  Q
    ||||||||||||||||||||||       |||||||||||||| ||||| |||||||||    
10748479 aaattacggagtatataacatgtttttctaaaataaattaagtgtgataaaagtattat 10748421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University