View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6548_low_29 (Length: 271)
Name: NF6548_low_29
Description: NF6548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6548_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 256
Target Start/End: Complemental strand, 14778447 - 14778205
Alignment:
| Q |
14 |
gaacaaattctacgtaagccaccaagagattatgtgaatatgaagttcctgaatcactttctgcatttggatgtactacttgaaattcgaatgagttcaa |
113 |
Q |
| |
|
||||||||||||||||||||| | | ||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14778447 |
gaacaaattctacgtaagccatctaaagattctgtgaatatgaagtttctgaatcactttctgcatttgaatgtactacttgaaattcgaatgagttcaa |
14778348 |
T |
 |
| Q |
114 |
acccaaccactgtatattaagacccttaaaaacatcctagtaatgtccatgcatttaccataacgaaggaaaaatatgaacatcaaacgttcacatgcaa |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14778347 |
acccaaccactatatattaagacccttaaaaacatactagtaatgtccatgcatttaccataacgaaggaaaaatatgaacatcaaacgttcagatgcat |
14778248 |
T |
 |
| Q |
214 |
gtgaaagttgcttcccctatatataggaacctatataattcct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14778247 |
gtgaaagttgcttcccctatatataggaacctatataattcct |
14778205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University