View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6548_low_32 (Length: 254)
Name: NF6548_low_32
Description: NF6548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6548_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 197
Target Start/End: Original strand, 4247312 - 4247501
Alignment:
| Q |
8 |
gagcagagacatatcaagagcaagtatggaaggattgcaaatttctcaagatattttcttttggtggattgaatattcattagtgaaaaaactattaatg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247312 |
gagcagagacatatcaagagcaagtatggaaggattgcaaatttctcaacatattttcttttggtggattgaatattcattagtgaaaaaactattaatg |
4247411 |
T |
 |
| Q |
108 |
aataaatcaaataatttatattaatggatgattaaccaattgaactttaatgaacttctaatggattataaatggattaattaattgtat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4247412 |
aataaatcaaataatttatattaatggatgattaaccaattgaactttaatgaacttctaatggattataaatggattaattaattgtat |
4247501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University